Entry information : TsPrx37 (Thhalv10028769m)
Entry ID 9807
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-31 (Christophe Dunand)
Peroxidase information: TsPrx37 (Thhalv10028769m)
Name (synonym) TsPrx37 (Thhalv10028769m)
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx37
start..stop
S start..stop
BrPrx37-1Aa_other 637 0 1..353 1..352
BstrPrx36 620 0 1..353 1..344
CrubPrx47 620 0 14..353 5..345
BstrPrx18 607 0 24..353 16..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11760760..11760990 231 N° 2 11759725..11759916 192 N° 3 11759402..11759570 169 N° 4 11758851..11759320 470
complement(join(11758851..11759320,11759402..11759570,11759725..11759916,1176076 0..11760990))


exon

Literature and cross-references TsPrx37 (Thhalv10028769m)
DNA ref. Phytozome 12:   scaffold_3 (11760990..11758851)
Protein sequence: TsPrx37 (Thhalv10028769m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   354 (323)
PWM (Da):   %s   38937.63 (35592.9)  
PI (pH):   %s   7.72 (7.68) Peptide Signal:   %s   cut: 31 range:31-353
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSSSSSSFDLTILMKMGVLLLLHVSLSQAQLSPSFYDKTCPQVFDIATKTIVNALRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFDVIDRMKAAVEKACPRTVSCADLLTIAAQKSVVLAGGPSWKVASGRRDGLKGFMDLANKNLPAPFFTLKELKESFKNVGLDRPSDLVALSGGHTFGKSQCQFIMDRLYDFNDSGLPDPTLDKSYLSTLRKQCPRNGNQSVLVDFDLRTPTVFDNKFYVNLKENKGLIQSDQELFSSSDASDTIPLVRAFADGQEKFFNAFVEAMKRMGDLSPITGKQGEIRLNCRVVNSKAKIMDMVDDNEFITSM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTCTTCTTCCTCATTTGATTTGACAATCCTAATGAAAATGGGAGTTCTCCTTCTTCTTCATGTATCATTGTCCCAAGCTCAACTAAGCCCTTCATTTTATGACAAAACA
TGTCCGCAAGTATTTGACATTGCAACCAAAACCATTGTCAATGCGTTGAGATCAGACCCTCGCATTGCAGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTCAAT
GTAAGATAC
CACTAGATTCAACATAATCACGTTCATAATTAGGTCAAATTAATTGTTTAAAACACTTCAATTGTAAACCGCCGTCTTCATATAGCTAAACTAGTAGTATGGCTTATACTATGGCTTATA
CTACTGTTTTATGGATATTGAATTTCTGATATACTTTTTTAAAAAATGATTAATGATAAATATGATACTTAATGCTTATACTGTCTTGTTAATGTTTTCATCTCCTATAGTTTATTTTTT
TCATAATTTTATTACGTTTTATCTGTTTTAAATTTAATATTTTGATACAATTGGATTTGATTAGGATATATCTCTACATAGATTTGTAGTTTTTTTTTTAAGTTCCTGATTCTGTCGTGA
AAGTATAGTCAATGATGATAAGTTAATAATTAGTAAACTCAAAATCTAACTTTTTTTAATATCAAGAAAAATGGATTTTTAATAATTATTTGTGTATTAGATCAAATCAATTATTAGTTT
TCTCTTCACCATCGAAATTCAAAAATCTAGACTTTGTAAGAATATCTCTTTATGAGTTTTTTCTGACACAGTGATTAAGTTACTCATGCTAGACAGCTCTGTGTAGCTTTGACTACTATA
TTTTGAATATCGATACTGCCTAAAAACATGGAACACCCTAGATTCATTGTTTTACGTACGCTAATGAAATTAATAGGAGTAATAGTAATACTGATGATAACAATAAAAAAAACGTAACGT
ACAGTTGTTGAATAAGTTAATAGTGACAGTGTGGAACTGTTTATAGATGATTCAAGTATGAAGATGGTCCCAGACTGAATCTGACGAGTGAAATTTGGTTTTGTTTTGTAACAGGGATGT
GATGCATCGATATTGTTAGATAACACAACATCGTTTAGGACGGAAAAAGATGCCTTTGGGAACGCAAATTCAGCTCGAGGCTTTGATGTGATCGATAGAATGAAAGCTGCCGTCGAGAAA
GCATGTCCTCGAACTGTTTCATGTGCTGATTTGCTAACCATCGCAGCTCAAAAGTCTGTCGTTTTG
GTATGCATCGTTTTACAATGCTACTCAGATATACATCTTTATTCTTTTTGCCAT
TTAGAAGCTGTTTCTAAGCCGTTATGTTAACTTATAAGAAGACCAAAAAATAATAGATCAAACATAATTGTTTACTTTAAATTGTCACATATACAAATAGGCGGGGGGTCCTTCATGGAA
GGTTGCAAGTGGAAGAAGAGACGGTTTAAAAGGGTTTATGGATCTTGCTAATAAAAATCTTCCAGCTCCATTCTTTACCCTTAAGGAACTTAAGGAAAGCTTCAAAAATGTCGGACTCGA
CCGCCCTTCTGATCTAGTTGCTCTTTCCG
GTACGTAATCATTGGAAAAGATTCAGACATAAGCAATATTTGTTGTCATTAATTACTAACTCTATATTATTACTGGTTTAGGTGGTCACAC
TTTTGGTAAAAGCCAATGTCAGTTTATAATGGACCGGCTTTACGACTTCAACGACTCCGGTTTACCTGACCCAACCCTTGATAAATCTTACCTCAGTACACTTAGAAAACAATGTCCTCG
CAATGGAAACCAAAGTGTCTTGGTGGATTTTGATTTACGTACACCAACAGTTTTTGACAACAAATTCTACGTGAATCTGAAAGAGAACAAAGGTCTTATTCAGAGTGACCAAGAGTTATT
CTCTAGTTCGGATGCTTCAGACACTATCCCATTAGTCCGAGCATTCGCCGATGGTCAAGAGAAATTTTTCAATGCGTTCGTGGAGGCAATGAAAAGGATGGGAGACCTTTCGCCTATAAC
CGGGAAACAAGGGGAAATTAGATTGAATTGTAGGGTGGTGAATTCGAAAGCCAAGATCATGGATATGGTAGATGATAATGAGTTTATCACCTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCTCTTCTTCTTCCTCATTTGATTTGACAATCCTAATGAAAATGGGAGTTCTCCTTCTTCTTCATGTATCATTGTCCCAAGCTCAACTAAGCCCTTCATTTTATGACAAAACA
TGTCCGCAAGTATTTGACATTGCAACCAAAACCATTGTCAATGCGTTGAGATCAGACCCTCGCATTGCAGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTCAAT
GGATGTGAT
GCATCGATATTGTTAGATAACACAACATCGTTTAGGACGGAAAAAGATGCCTTTGGGAACGCAAATTCAGCTCGAGGCTTTGATGTGATCGATAGAATGAAAGCTGCCGTCGAGAAAGCA
TGTCCTCGAACTGTTTCATGTGCTGATTTGCTAACCATCGCAGCTCAAAAGTCTGTCGTTTTG
GCGGGGGGTCCTTCATGGAAGGTTGCAAGTGGAAGAAGAGACGGTTTAAAAGGGTTT
ATGGATCTTGCTAATAAAAATCTTCCAGCTCCATTCTTTACCCTTAAGGAACTTAAGGAAAGCTTCAAAAATGTCGGACTCGACCGCCCTTCTGATCTAGTTGCTCTTTCCG
GTGGTCAC
ACTTTTGGTAAAAGCCAATGTCAGTTTATAATGGACCGGCTTTACGACTTCAACGACTCCGGTTTACCTGACCCAACCCTTGATAAATCTTACCTCAGTACACTTAGAAAACAATGTCCT
CGCAATGGAAACCAAAGTGTCTTGGTGGATTTTGATTTACGTACACCAACAGTTTTTGACAACAAATTCTACGTGAATCTGAAAGAGAACAAAGGTCTTATTCAGAGTGACCAAGAGTTA
TTCTCTAGTTCGGATGCTTCAGACACTATCCCATTAGTCCGAGCATTCGCCGATGGTCAAGAGAAATTTTTCAATGCGTTCGTGGAGGCAATGAAAAGGATGGGAGACCTTTCGCCTATA
ACCGGGAAACAAGGGGAAATTAGATTGAATTGTAGGGTGGTGAATTCGAAAGCCAAGATCATGGATATGGTAGATGATAATGAGTTTATCACCTCTATGTGA

Retrieve as FASTA