Entry information : TsAPx05 (Thhalv10028759m)
Entry ID 9808
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-31 (Christophe Dunand)
Peroxidase information: TsAPx05 (Thhalv10028759m)
Name (synonym) TsAPx05 (Thhalv10028759m)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsAPx05
start..stop
S start..stop
BnAPx04-1Aa_other 637 0 1..360 1..354
BoAPx03_other 615 0 1..360 1..351
AlyAPx05 577 0 1..360 1..370
CagraAPx05 560 0 1..360 1..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14513396..14513590 195 N° 2 14513673..14513822 150 N° 3 14514601..14514721 121 N° 4 14514803..14514903 101
N° 5 14514966..14515053 88 N° 6 14515185..14515252 68 N° 7 14515329..14515415 87 N° 8 14515533..14515607 75
N° 9 14515699..14515776 78 N° 10 14515868..14515972 105 N° 11 14516200..14516214 15  
join(14513396..14513590,14513673..14513822,14514601..14514721,14514803..14514903 ,14514966..14515053,14515185..14515252,14515329..14515415,14515533..14515607,145 15699..14515776,14515868..14515972,14516200..14516214)


exon

Literature and cross-references TsAPx05 (Thhalv10028759m)
DNA ref. Phytozome 11:   scaffold_3 (14513396..14516214)
Protein sequence: TsAPx05 (Thhalv10028759m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361
PWM (Da):   %s   39552.9  
PI (pH):   %s   7.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAERVSLTLNTNTDTNTMSSLRTQISATRLLCSSSRSRLALSASSSPSSLSFTRSLVSSPLLSQIKRDQVALVNRSFSSSSATTKCTSATDPEQLKSAREDIKELLNTKFCHPILVRLGWHDAGTYNKNIKEWPQRGGANGSLRYEIELKHAANAGLVNALNLIQHIKEMYSGISYADLFQLASATAIEAGGPKIPMKYGRVDTSSPHECPEEGRLPDAGPPSPANHLREVFYRMGLDDDIVALSGAHTLGRSRPERSGWGKPETKYTKEGPGAPGGQSWTPEWLKFDNSYFKEIKEKRDEDLLVLPTDAAIFEDPSFKVYAEKYAADQDAFFNDYAESHAKLSNVGAKFNPPEGITI*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGTGTGTCTCTCACACTCAACACCAACACCGACACCAACACCATGTCTTCTCTTCGCACTCAAATCTCTGCTACTCGTCTCCTCTGCTCTTCCTCCAGATCTAGACTCGCT
CTTTCCGCTTCATCTTCACCTTCGTCTCTCTCATTCACCAGATCTCTCGTCTCTTCTCCGCTTCTCTCTCAGATA
GTCTCTCCCTCCCTCCCTCTCTCTCCCGCTAATCTTCATTTCTCT
TTTTGTTGTTATTGATTTTTTTTTTCGGATTTTCCAGAAGAGAGATCAAGTTGCGTTGGTGAATCGGAGCTTTAGCTCGTCTTCCGCAACTACTAAATGTACATCAGCTACGGATCCTGA
ACAATTGAAGAGTGCTAGAGAAGATATCAAAGAGCTTCTCAACACCAAGTTCTGCCATCCAATTTTG
GTTGGTTTTCTCTTCTATTGTCCTCAAGATATCGCTATTTTATCATTTATACA
GTATAAGGAATTACGATAAACACAGTGAAGCTGAAACGTTTTTGGGACAAAGCTAATTAATATTGTCCGTTGACTCGAGGTTATTTGTTAAGCTGTTCTCTGATTCCTACTTCTCACAAT
CCTTTAAACATCATACGGAGTTATCGTGTTGAAGGTGTTCTTTCCTGAATTCGCCATTACTCCCCAGTTTCGAGAGAAGAAAGCAAGGCTTTAGAACGGAATGTGTGCTATAGGAATCTA
GTTTTCTCCTTCATTAGCACAGAATGCTCGCTATAGGAACCTAGTTTTCTCTTTTACGAAATGCTCGAGAAAGGAATCTAGTGTTCTCCTTCATTAGCACAGAATGCTTGCTATAGGAAT
CTAGTTTTCTCTATTATGGAATGCTTGCGAAAGGAATATAGTTTTCTCCTTCATTAGCACGGAATGCTCGCGATAGGAATCTAGTTTTCTATTTTGTTTGCACAGAATGCATGCTACAGG
AATTTTATTTGCACAGAATGCTTGCTACAGGAATCTAGTTTTCTATTTTATTAGCACAGAATGCTTGCTACAGGAAACTAGTTTTCTCTTTTATGGAATGCTCGCGATTGGGAATCTAGT
TCTCTCTTTTATTAGCACTTTTGTATTTTATTGGCACAGAATTGCTATGGTTTGTTGTTGTATTTTTTTTTATCTGAATACTTTTTAAATATTGTTTTGCTGCATATTATGTTTGTGTAT
CACAGGTTCGTTTAGGGTGGCATGATGCTGGCACGTACAACAAGAACATCAAGGAGTGGCCTCAGAGAGGTGGAGCTAATGGGAGTCTGAGATACGAGATTGAGCTTAAGCATGCTGCTA
ATGCCG
GTATCATTTACATACCATAGGAGTGGCTTATTTTTACTTCTTTGTGACCATGTTTAATCATAGGCTTGTTGTTGCTTTCAGGTCTTGTGAATGCTTTAAACCTGATTCAGCACA
TCAAAGAAATGTACTCTGGGATCTCGTATGCTGACCTATTCCAATTAGCCAGTGCTACTGCTATAGAG
GTAAATTCTAGTATTACTTAAACTGGTCGTGAAAATGTTTACTAAACTTTCG
GAAAATTTAGGAAGCCGGAGGACCAAAAATACCTATGAAATATGGAAGAGTTGATACCTCCAGTCCTCATGAATGTCCTGAAGAAGGAAGGCTCCCAGGTAAGCTTCTTATTTATGGTGT
TCGCCTCTGCTTTGAATCACTAATCTTTGCGGATGTCTTTTGGTTACATAATTTTATCAACATTTTACTAATTGCAAATATCATATGTTTCCTCATATTTGTTCTATAGACGCTGGTCCT
CCTTCACCCGCTAATCATCTCAGAGAAGTTTTTTACAGAATGGGACTCGATGACAAG
GTAATTGCTGTTAAATATTCATAACTATGGAAGATCAATGAGTAAAAGATCAGTATCGAAAGA
TTTTGAACTGCAGGACATAGTTGCATTATCTGGTGCCCACACCTTAGGAAGATCTAGGCCAGAACGTAGTGGTTGGGGGAAGCCAGAGACGAAGTACACGGTATTATTTCCTGTCCAGTT
CTATAACGTATTGTTGATAAAAGTTGTCATTTTTGGGACTGGAAAAAGTAAATGGAATACGATTTTCTAGCTCTTACTATGTGTTTTTGCATTATAGAAAGAGGGACCGGGCGCACCAGG
AGGACAGTCATGGACACCAGAGTGGCTGAAGTTTGACAACTCTTACTTCAAA
GTTGGTTCATTACATAACTCTTTCTTCACATTTAGAAGTGAAAGTTTTCCTTTTTGTCCCTCGATGTC
TATTAATTTAATTGTTATAACAGGAAATCAAGGAAAAGAGAGATGAAGATCTCCTAGTCCTACCCACTGACGCTGCCATCTTTGAAGATCCTTCTTTCAAGGTAAAAAACAAACAATAAA
GTTGAAACATATGAATACGAAGGAACTTGCCGAGTCTTTGTCGTAAAAACTGAAACCGTGATGTAATTGCAGGTGTACGCTGAGAAGTATGCTGCAGATCAGGATGCATTCTTTAATGAT
TACGCTGAATCCCATGCAAAGCTCAGCAATGTTGGAGCAAAATTCAACCCTCCCGAG
GTTTGCAATTCTTATATTTTGTTATGTTTATACTATATAGCATCAAAGCCATTATCATTGTCC
AGTGCTTGTGAAAGTAGGAAGTCGTGTTCGATCAAAAAGACGCGCTACATCAAAATTGCGATGAATTTAGAACCATGTTATCTAAATAGATAGATATCATTTTTTTTTTTTTGGCACTTG
AGAGTTTCCATTGATGAGTGAATAAATCTTAATCTTTTTTTTAGGGTATCACTATCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGAGCGTGTGTCTCTCACACTCAACACCAACACCGACACCAACACCATGTCTTCTCTTCGCACTCAAATCTCTGCTACTCGTCTCCTCTGCTCTTCCTCCAGATCTAGACTCGCT
CTTTCCGCTTCATCTTCACCTTCGTCTCTCTCATTCACCAGATCTCTCGTCTCTTCTCCGCTTCTCTCTCAGATA
AAGAGAGATCAAGTTGCGTTGGTGAATCGGAGCTTTAGCTCGTCT
TCCGCAACTACTAAATGTACATCAGCTACGGATCCTGAACAATTGAAGAGTGCTAGAGAAGATATCAAAGAGCTTCTCAACACCAAGTTCTGCCATCCAATTTTG
GTTCGTTTAGGGTGG
CATGATGCTGGCACGTACAACAAGAACATCAAGGAGTGGCCTCAGAGAGGTGGAGCTAATGGGAGTCTGAGATACGAGATTGAGCTTAAGCATGCTGCTAATGCCG
GTCTTGTGAATGCT
TTAAACCTGATTCAGCACATCAAAGAAATGTACTCTGGGATCTCGTATGCTGACCTATTCCAATTAGCCAGTGCTACTGCTATAGAG
GAAGCCGGAGGACCAAAAATACCTATGAAATAT
GGAAGAGTTGATACCTCCAGTCCTCATGAATGTCCTGAAGAAGGAAGGCTCCCAG
ACGCTGGTCCTCCTTCACCCGCTAATCATCTCAGAGAAGTTTTTTACAGAATGGGACTCGATGAC
AAG
GACATAGTTGCATTATCTGGTGCCCACACCTTAGGAAGATCTAGGCCAGAACGTAGTGGTTGGGGGAAGCCAGAGACGAAGTACACGAAAGAGGGACCGGGCGCACCAGGAGGACAG
TCATGGACACCAGAGTGGCTGAAGTTTGACAACTCTTACTTCAAA
GAAATCAAGGAAAAGAGAGATGAAGATCTCCTAGTCCTACCCACTGACGCTGCCATCTTTGAAGATCCTTCTTTC
AAG
GTGTACGCTGAGAAGTATGCTGCAGATCAGGATGCATTCTTTAATGATTACGCTGAATCCCATGCAAAGCTCAGCAATGTTGGAGCAAAATTCAACCCTCCCGAGGGTATCACTATC
TAA

Retrieve as FASTA