Entry information : SbRboh04 (Sobic.003G175000.1[2.1] / Sb03g022070[1.4])
Entry ID 981
Creation 2008-11-18 (Christophe Dunand)
Last sequence changes 2015-12-09 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-15 (Christophe Dunand)
Peroxidase information: SbRboh04 (Sobic.003G175000.1[2.1] / Sb03g022070[1.4])
Name (synonym) SbRboh04 (Sobic.003G175000.1[2.1] / Sb03g022070[1.4])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Leaves
Seedlings
Inducers Colletotrichum inoculation
Heat shock stress
Pathogen interaction
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh04
start..stop
S start..stop
ZmRboh09 1570 0 1..827 1..822
OsRboh04 1443 0 4..827 2..819
SbRboh05 1339 0 14..827 33..854
OsRboh03 1318 0 28..827 37..843
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42498065..42498389 325 N° 2 42498613..42498775 163 N° 3 42498857..42498905 49 N° 4 42499180..42499293 114
N° 5 42499402..42499824 423 N° 6 42499920..42500306 387 N° 7 42500413..42500508 96 N° 8 42500637..42500752 116
N° 9 42500853..42500955 103 N° 10 42501046..42501134 89 N° 11 42501377..42501527 151 N° 12 42501604..42501753 150
N° 13 42501869..42501997 129 N° 14 42502108..42502186 79 N° 15 42502315..42502424 110  
join(42498065..42498389,42498613..42498775,42498857..42498905,42499180..42499293 ,42499402..42499824,42499920..42500306,42500413..42500508,42500637..42500752,425 00853..42500955,42501046..42501134,42501377..42501527,42501604..42501753,4250186 9..42501997,42502108..42502186,42502315..42502424)


exon

Literature and cross-references SbRboh04 (Sobic.003G175000.1[2.1] / Sb03g022070[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_3 (42498065..42502424)
Cluster/Prediction ref. UniGene:   Sbi.1848 [3' end]
Protein sequence: SbRboh04 (Sobic.003G175000.1[2.1] / Sb03g022070[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   827
PWM (Da):   %s   93445.91 Transmb domain:   %s   o276-295i408-430o457-479i644-661o
PI (pH):   %s   9.76
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSAGYAGGDTGGLGDGEPPPPVPPQMRKQPSRIASGMRRLASKVSSAVPEMRGHKHTHSGAQSGLRGLRFLDKTSAGKDGWKTVEKRFDEMSTDGRLQRENFAKCIGMADSKEFASEVFVALSRRRHINPDDGVTKEQLKEFWEEMTDQNFDSRLRIFFDMCDKNGDGKLTEDEVKIMVLSASANKLAKLKKHAGTYASLIMEELDPDHRGYIEIWQLETLLRGMVSASGPPDKMNMASQSLTRTMVPSSHRSPLQRRMNMAVDFVHENWKRIWVISLWGALNIALFVFKFIQYRRRAVFEVMGYCVCIAKGAAETLKLNMALILLPVCRNTLTRLRSTALSKVVPFDDNINFHKVIALTIAIGAATHTLSHVLCDFPRLVSCPKDKFMEKLGPFFNYVQPTWPILLTSIPGWTGILLILIMSFSFTLATHSFRRSVVKLPSPLHHLAGFNAFWYAHHLLVIAYVLLVMHSYFIFLTKQWYKRTTWMYLAVPVIFYASERSIRKIRERSYRVSIIKAAIYPGNVLSIYMKKPPSFKYKSGMYLFVKCPDVSPFEWHPFSITSAPGDDYLSVHIRTLGDWTSELRNLFGACEAEVTSKKATLARLETTVVAHGLAEDTRFPKVFIDGPYGAPAQNYRKYDILLLIGLGIGATPFISILKDLLNNIKSNEMESTHDTELGCSFKTNGPGRAYFYWVTREQGSFEWFKSVMNEVAESDRDDVIEMHNYLTSVYEEGDARSALIAMVQSLQHAKNGVDIVSGSKIRTHFARPNWRKVFSDLASAHKNSRIGVFYCGSPTLTKTLRDLSIEFSSTTTTRFHFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, 14 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGTCGGCGGGGTACGCCGGTGGCGACACGGGAGGTCTGGGCGACGGGGAGCCCCCGCCCCCGGTGCCGCCGCAGATGAGGAAGCAGCCGTCGCGGATCGCGTCGGGGATGCGT
CGGCTGGCGTCGAAGGTGTCGTCGGCGGTGCCAGAGATGCGGGGCCACAAGCATACACACTCGGGCGCGCAGTCGGGCTTGCGCGGGCTGCGCTTCCTCGACAAGACCTCTGCCGGCAAG
GACGGCTGGAAGACCGTCGAGAAGCGGTTCGACGAGATGAGCACCGACGGCCGGCTGCAGAGGGAGAACTTCGCCAAGTGCATCG
GTGAGTCTTGCTGAGACCTGTCCCTGTCACGGGCT
CACGGCTCGTCGTCTCGGTGATGTGATATATATGATCTGTCTATCCTGTAGAATGAGAACGACGATGCTAGGTTTTCTTTATGAAAGACATATGCATGTAAATTTGTTGAGAAAAAGTTG
ATCTATTTTGTGCTGGATTGGATGTATGATTACCTGATGCTCCGCTATATATAATCTGCGTCTTAAAGGTATGGCTGATTCAAAGGAGTTTGCAAGCGAGGTATTTGTGGCATTGTCTAG
GAGAAGACACATCAATCCGGACGACGGTGTAACAAAAGAACAACTAAAGGAGTTCTGGGAGGAGATGACAGACCAGAACTTTGATTCCCGGCTACGCATTTTCTTTGACAT
GTAAACCTG
ACCTCCAGTTCCCTTCGTTTCCATACTGAAATACGGATTGCTTTCGTCTTGACGAGATGTGCTTGCAACCAGGTGTGACAAGAACGGTGATGGTAAGCTGACAGAAGATGAGGTCAAGGA
G
GTTAGCTTCTAGTGTTCGAACAAGTAGTTATGGCAGATGTTCTGCCAAGTGTTAACTTGTACTCCCTCCGTCCCAGTATATAAGGCGCAACTACCTCTGGTTCAAAGACCAAGAACGCA
TTTAATTCTCTCTCAGCACTAGTACTACTACATTAATGTTTGTGAGAGAGCACGCCTTATATTATAGGACATGAATAAAAAGTGGTTACGCCTTATATACTAGGACGGAGGGAGTATAAG
TGTAAAATTTCTATTTCACGATCATTTGTGTGCAGATCATGGTGCTAAGTGCCTCAGCAAACAAGCTTGCCAAACTGAAGAAACATGCTGGAACCTACGCCTCTCTGATCATGGAGGAGC
TGGACCCTGATCACCGCGGCTACATTGAG
GTGCACGATCCCGGACATCTATCGAAACCCTTTATTAATTTGCTTCTCTCAGACAGTCAGTCAGCGACAGAGCAGCAGCATAGAGTACTGA
CAGAAAACAGAAAACAGATTTGGCAGCTGGAGACCCTGCTTCGGGGGATGGTGTCGGCCTCAGGGCCGCCGGACAAGATGAACATGGCGTCCCAATCTCTGACGAGGACGATGGTGCCTT
CCAGCCACCGGAGCCCACTGCAGCGGCGCATGAACATGGCTGTGGACTTCGTCCATGAGAACTGGAAGAGGATATGGGTGATCTCCCTCTGGGGCGCCCTCAACATCGCCCTCTTCGTAT
TCAAGTTCATCCAGTACCGGAGGCGCGCGGTGTTCGAGGTGATGGGCTACTGCGTCTGCATCGCCAAGGGCGCCGCCGAGACCCTCAAGCTCAACATGGCGCTCATACTGCTGCCGGTGT
GCCGGAACACGCTCACAAGGCTGCGGTCCACCGCGCTCAGCAAGGTCGTGCCGTTCGACGACAACATAAACTTCCACAAG
GTACGGTGCTGAGCTTGCCACACACAATGTTCGCAATAAA
TGCATCTATCTGGCTGGCATGTTCGTTCGCAATGACATTGTCCATCATAATGTAGGTCATCGCGCTTACAATCGCCATAGGAGCTGCAACCCATACGCTTTCACACGTCCTCTGCGACTT
CCCCAGGCTGGTGTCGTGCCCCAAGGACAAGTTCATGGAGAAGCTGGGGCCCTTCTTCAACTACGTTCAGCCAACATGGCCGATTCTGCTGACGAGCATCCCGGGATGGACCGGGATCCT
CCTCATCCTCATAATGTCCTTCTCCTTCACGCTCGCCACGCACTCCTTCCGGAGGAGCGTCGTGAAGCTGCCGTCACCGCTGCACCACCTGGCCGGCTTCAACGCCTTCTGGTATGCCCA
CCACCTGCTGGTGATCGCCTATGTCCTCCTGGTGATGCACTCATACTTCATATTCCTCACCAAGCAGTGGTACAAGAGAACG
GTACGTATTATTTTTGTTCAGTATTATTTGATATATAT
ATATATATATATATGTGTGACCAACAAGCTTGAATTGGAATCCCAATTTAATTTGCTTGCCTTTTCAGACATGGATGTACTTGGCAGTCCCTGTCATCTTCTATGCCTCTGAGAGAAGTA
TCAGAAAAATTCGTGAGAGAAGCTATCGCGTGAGCATCATAAAG
GTAAAGTGATATATATGGTCCCTTTTCAGTTTGTTTGCTGTCTTAATATAAATAAATTTCTCCTTATATTACTTCT
GCAAGCGGACTTCTATTATTAATTTATATATATATATTTATGTGTCACACAGGCAGCAATTTACCCTGGAAACGTGCTCTCAATTTACATGAAGAAGCCACCAAGCTTCAAGTACAAAAG
TGGGATGTACCTGTTTGTAAAATGCCCAGACGTTTCACCTTTTGAATG
GTACCAAGGCCCGCAGCATTGTCATTTTCAAGTCAGCATGATGACACTCCTAAAGAACTAAACTGTCCTAAT
AAGATTCGTCCATATCTCTGCAATGCAGGCACCCCTTCTCTATCACTTCGGCTCCTGGAGATGACTACTTGAGCGTTCATATCCGTACATTAGGTGATTGGACATCAGAACTCAGGAATC
TATTTGGGAAG
GTCAGTTGACCGAGCACTTCAGAAAGGGGAAAAAAATCTGGAGCCTATTTCCTCATAGTAAGTTTGACATGAAAAATATGTTTCATGCAGGCTTGTGAAGCAGAAGTAA
CTTCTAAGAAGGCTACACTAGCTAGACTTGAAACAACTGTTGTGGCACATGGTCTGGCAGAGGACACTAG
GTGATTGATTGCCTCATCTGTTTCATATATATGCTGTCTGGCTGTAGAAT
GTTTTCCTGAGTACATTTGGTAACACTACAACACTACGGTGAGAGAGTTATCACAAAGTGGCACTTTAATCAACACTCAACAGGTTGACAAGGCTTTAATTTGACTGGGAAGTTTGTCAT
AAGACGTCACCTATTTTCTTTTTTAAAAAAGCTATATGCTTAGTTCAATCTGACTTGGCTTTATTCATTTAGGTTTCCTAAAGTCTTCATAGACGGCCCTTATGGTGCACCGGCTCAAAA
CTACCGGAAATATGACATTCTTTTGCTTATCGGGCTCGGGATTGGTGCAACTCCTTTCATCAGCATACTGAAGGATCTCCTCAACAACATAAAGTCCAACCAG
GTAAAACTGTGCTGAGC
TCTTGCAAATCTTTTCCAAATGGACAGCAAAAATGTTCAGTTCAGTTGCATTGAAACAGGAGATGGAGAGCACGCATGACACGGAGTTAGGTTGCAGCTTCAAGACGAATGGGCCAGGAA
GAGCCTACTTCTACTGGGTTACCAGAGAGCAAGGCTCCTTCGAGTGGTTCAAAAGTGTCATGAACGAAGTTGCCGAGAGTGATCGTGAT
GTACTTACTGATCTGATGCTCACAACTAATT
AATACATCCCTCCATTCCTAACTGGCTAATTATTACCAGAAAATTCAGAGTGATACATCCTCCTCGTTCTATCTATGCATACAGGATGTGATAGAGATGCACAATTACCTGACCAGCGTG
TACGAAGAAGGCGACGCGAGGTCAGCCCTGATTGCCATGGTCCAGTCACTTCAACATGCCAAGAACGGCGTGGATATTGTCTCAGGCAGCAAG
GTGAAAGAAAGAAACAAGCATCTCCTT
TCATTTCCTCTGTCTCTCTTATCTGCACAAAATTCAGATATGCTGTACCTGTTTCCAGTTCTGAGTGACCTTTGGATTTGCAGATTCGAACGCATTTTGCAAGGCCAAACTGGAGAAAAG
TCTTCTCTGATCTGGCCAGTGCTCACAAGAACTCACGGATAG
GTGAGTTTAATATATGATACTAAAATCAGAGAACCCACCTTGTTTTGATGATGAAGAAGATAAGAAAATCGACCGACG
TACATAGCTAATGCACAAATATTTATTAAGAAATTGATCTTGGCACGCAGGTGTCTTCTACTGTGGATCTCCAACACTTACGAAGACCCTAAGAGATCTTTCAATAGAGTTCAGCAGTAC
CACGACGACCCGATTCCATTTCCACAAAGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATCGTCGGCGGGGTACGCCGGTGGCGACACGGGAGGTCTGGGCGACGGGGAGCCCCCGCCCCCGGTGCCGCCGCAGATGAGGAAGCAGCCGTCGCGGATCGCGTCGGGGATGCGT
CGGCTGGCGTCGAAGGTGTCGTCGGCGGTGCCAGAGATGCGGGGCCACAAGCATACACACTCGGGCGCGCAGTCGGGCTTGCGCGGGCTGCGCTTCCTCGACAAGACCTCTGCCGGCAAG
GACGGCTGGAAGACCGTCGAGAAGCGGTTCGACGAGATGAGCACCGACGGCCGGCTGCAGAGGGAGAACTTCGCCAAGTGCATCG
GTATGGCTGATTCAAAGGAGTTTGCAAGCGAGGTA
TTTGTGGCATTGTCTAGGAGAAGACACATCAATCCGGACGACGGTGTAACAAAAGAACAACTAAAGGAGTTCTGGGAGGAGATGACAGACCAGAACTTTGATTCCCGGCTACGCATTTTC
TTTGACAT
GTGTGACAAGAACGGTGATGGTAAGCTGACAGAAGATGAGGTCAAGGAGATCATGGTGCTAAGTGCCTCAGCAAACAAGCTTGCCAAACTGAAGAAACATGCTGGAACCTAC
GCCTCTCTGATCATGGAGGAGCTGGACCCTGATCACCGCGGCTACATTGAG
ATTTGGCAGCTGGAGACCCTGCTTCGGGGGATGGTGTCGGCCTCAGGGCCGCCGGACAAGATGAACATG
GCGTCCCAATCTCTGACGAGGACGATGGTGCCTTCCAGCCACCGGAGCCCACTGCAGCGGCGCATGAACATGGCTGTGGACTTCGTCCATGAGAACTGGAAGAGGATATGGGTGATCTCC
CTCTGGGGCGCCCTCAACATCGCCCTCTTCGTATTCAAGTTCATCCAGTACCGGAGGCGCGCGGTGTTCGAGGTGATGGGCTACTGCGTCTGCATCGCCAAGGGCGCCGCCGAGACCCTC
AAGCTCAACATGGCGCTCATACTGCTGCCGGTGTGCCGGAACACGCTCACAAGGCTGCGGTCCACCGCGCTCAGCAAGGTCGTGCCGTTCGACGACAACATAAACTTCCACAAG
GTCATC
GCGCTTACAATCGCCATAGGAGCTGCAACCCATACGCTTTCACACGTCCTCTGCGACTTCCCCAGGCTGGTGTCGTGCCCCAAGGACAAGTTCATGGAGAAGCTGGGGCCCTTCTTCAAC
TACGTTCAGCCAACATGGCCGATTCTGCTGACGAGCATCCCGGGATGGACCGGGATCCTCCTCATCCTCATAATGTCCTTCTCCTTCACGCTCGCCACGCACTCCTTCCGGAGGAGCGTC
GTGAAGCTGCCGTCACCGCTGCACCACCTGGCCGGCTTCAACGCCTTCTGGTATGCCCACCACCTGCTGGTGATCGCCTATGTCCTCCTGGTGATGCACTCATACTTCATATTCCTCACC
AAGCAGTGGTACAAGAGAACG
ACATGGATGTACTTGGCAGTCCCTGTCATCTTCTATGCCTCTGAGAGAAGTATCAGAAAAATTCGTGAGAGAAGCTATCGCGTGAGCATCATAAAGGCA
GCAATTTACCCTGGAAACGTGCTCTCAATTTACATGAAGAAGCCACCAAGCTTCAAGTACAAAAGTGGGATGTACCTGTTTGTAAAATGCCCAGACGTTTCACCTTTTGAATG
GCACCCC
TTCTCTATCACTTCGGCTCCTGGAGATGACTACTTGAGCGTTCATATCCGTACATTAGGTGATTGGACATCAGAACTCAGGAATCTATTTGGGAAG
GCTTGTGAAGCAGAAGTAACTTCT
AAGAAGGCTACACTAGCTAGACTTGAAACAACTGTTGTGGCACATGGTCTGGCAGAGGACACTAG
GTTTCCTAAAGTCTTCATAGACGGCCCTTATGGTGCACCGGCTCAAAACTACCGG
AAATATGACATTCTTTTGCTTATCGGGCTCGGGATTGGTGCAACTCCTTTCATCAGCATACTGAAGGATCTCCTCAACAACATAAAGTCCAACCAG
GAGATGGAGAGCACGCATGACACG
GAGTTAGGTTGCAGCTTCAAGACGAATGGGCCAGGAAGAGCCTACTTCTACTGGGTTACCAGAGAGCAAGGCTCCTTCGAGTGGTTCAAAAGTGTCATGAACGAAGTTGCCGAGAGTGAT
CGTGAT
GATGTGATAGAGATGCACAATTACCTGACCAGCGTGTACGAAGAAGGCGACGCGAGGTCAGCCCTGATTGCCATGGTCCAGTCACTTCAACATGCCAAGAACGGCGTGGATATT
GTCTCAGGCAGCAAG
ATTCGAACGCATTTTGCAAGGCCAAACTGGAGAAAAGTCTTCTCTGATCTGGCCAGTGCTCACAAGAACTCACGGATAGGTGTCTTCTACTGTGGATCTCCAACA
CTTACGAAGACCCTAAGAGATCTTTCAATAGAGTTCAGCAGTACCACGACGACCCGATTCCATTTCCACAAAGAGAATTTCTAA

Retrieve as FASTA