Entry information : TsPrx48-2 (Thhalv10027558m)
Entry ID 9811
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2012-07-27 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-08-13 (Qiang Li)
Peroxidase information: TsPrx48-2 (Thhalv10027558m)
Name (synonym) TsPrx48-2 (Thhalv10027558m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx48-2
start..stop
S start..stop
AtPrx48 629 0 1..413 1..403
AlyPrx48 628 0 1..413 1..404
AhalPrx36 625 0 1..413 1..404
BrPrx48-1Aa_other 622 0 1..413 2..400
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2617946..2618314 369 N° 2 2618634..2618822 189 N° 3 2618904..2619069 166 N° 4 2619202..2619728 527
join(2617946..2618314,2618634..2618822,2618904..2619069,2619202..2619728)


exon

Literature and cross-references TsPrx48-2 (Thhalv10027558m)
DNA ref. Phytozome 11:   scaffold_1 (2617946..2619728)
Protein sequence: TsPrx48-2 (Thhalv10027558m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   416
PWM (Da):   %s   45782.64 Transmb domain:   %s   i7-26o
PI (pH):   %s   4.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRFIGDWKIAFATCFFIALSIYVARLEFDNVVLHFLRLAKDFPENHTGGKVSEKSPYEEDFMTMFMSTAEDIDRSYSLHYDFYQESCPSAERIIAKAITETYNARPSIAPSLIRLLFHDCFIEGCDASVLLDADESLTSEKEASPNQSLKGLDVIDAIKSELENVCPGVVSCADIIVLAAREAVLLAGGPFYPLETGRKDSVAAFKEIAERELPTPQANLSVILARFASRGFNERETVSLFGAHSIGTTHCTFFEDRLYNFAGTGKPDPELNPGFLQELKTKCPFSASASSPSPSPGTGLAPSLPASDCPKNYGMSPTGGNDGVIDLSFNNEGGEENFGTRYFRRLMQKKGLLFSDQQLTSSEETETWVRAYASDPQLFRRDFAMSMMKLSSYHVLTGPLGQVRTTCSKVLPKELI

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome: intron 2 is missing. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTATCGGAGATTGGAAGATCGCTTTCGCTACCTGCTTCTTTATCGCTCTCAGCATCTACGTCGCGCGCCTCGAATTTGACAACGTCGTTCTCCATTTTCTCCGTTTGGCTAAA
GATTTCCCGGAGAATCATACCGGCGGTAAGGTTTCTGAGAAATCTCCCTACGAGGAGGATTTCATGACCATGTTCATGTCTACCGCCGAAGATATCGATCGATCTTACTCCCTCCACTAC
GATTTCTACCAAGAATCTTGCCCTTCCGCCGAGAGAATCATCGCTAAAGCTATCACAGAAACCTACAACGCCAGACCTAGCATAGCTCCGTCTCTCATCCGCCTCCTATTTCACGATTGC
TTTATCGAG
GTCAGATTTTCCGATTCGTTGCTTTCTCTTTCTCGTCTCTTCTGATATAGTCTGGGTAAATCTTCGGCATCTTAGCAGTAGGAGAAATTTAGGGTAGATTGTTCGTGAAAC
CTCAAACAATTTCTTGATTCGGGAGTGTATAACTGATTGTGATATCTTTGTTTCAATTGAAGTTCATCTCTGTCAATGGAATTAAGCTTGGTCAATAAAGAATCTATGTGCTTATATCCC
TCTGATTTGTTGTTGTTAGGATACTTTGTGAACCGAATCTTATGTTTCCTTGGATTTCTTCAAGTTGCTCATGTTGCTTTATATACAGGGATGTGATGCATCAGTCCTTCTAGACGCAGA
TGAATCTCTAACTTCTGAGAAAGAAGCATCTCCGAACCAGTCTTTGAAAGGGCTTGATGTGATTGACGCAATTAAGTCTGAGCTAGAGAACGTCTGTCCTGGAGTTGTTTCCTGCGCCGA
CATTATTGTCTTGGCTGCTAGAGAAGCCGTCCTTTTG
GTAAATCTCCATGCCTCTCTTCTTGTTTTGTCCATGTTGATTATCTCTGTAACCCTGAATCATGTCTTTGGAACTCCACAGGC
TGGTGGTCCATTTTATCCACTGGAGACTGGAAGGAAAGATAGTGTAGCGGCCTTCAAGGAAATTGCAGAACGAGAGCTTCCAACACCACAAGCTAATCTCTCGGTAATTCTTGCAAGGTT
TGCTTCCAGAGGATTCAACGAGAGAGAAACCGTCAGTTTATTCG
GTAATCCTCACTTCTTGTGCCAACATCTCTCTCCCCTGCTTTGGCTATATCTTGTCGTTCTTGGAATTGGTTTACT
CTTTCTCTTCGTGACATGATTCTTTTCTTACTCTTACTCTGATTTTTCTGACGCAGGAGCACACAGCATAGGCACTACGCACTGCACATTCTTTGAGGACCGGCTATACAACTTCGCAGG
AACGGGGAAGCCTGACCCTGAACTCAATCCAGGGTTCCTCCAAGAACTGAAAACCAAATGCCCCTTCTCTGCCTCGGCTTCATCTCCATCACCATCCCCTGGCACTGGTTTAGCACCTTC
CTTACCTGCATCAGATTGTCCCAAGAACTATGGTATGAGCCCAACAGGCGGGAATGATGGAGTGATCGACTTGAGCTTCAACAATGAAGGAGGTGAGGAGAATTTCGGAACACGCTACTT
CAGAAGATTGATGCAGAAGAAAGGGTTGTTGTTTTCTGATCAGCAGCTAACGAGCAGTGAAGAGACTGAGACATGGGTGAGAGCCTATGCTTCAGATCCACAGTTGTTCCGACGTGACTT
TGCCATGTCGATGATGAAGTTATCAAGTTACCATGTCTTGACTGGTCCTCTAGGTCAAGTCAGAACAACATGCTCAAAGGTCCTGCCCAAGGAACTGATTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGTTTATCGGAGATTGGAAGATCGCTTTCGCTACCTGCTTCTTTATCGCTCTCAGCATCTACGTCGCGCGCCTCGAATTTGACAACGTCGTTCTCCATTTTCTCCGTTTGGCTAAA
GATTTCCCGGAGAATCATACCGGCGGTAAGGTTTCTGAGAAATCTCCCTACGAGGAGGATTTCATGACCATGTTCATGTCTACCGCCGAAGATATCGATCGATCTTACTCCCTCCACTAC
GATTTCTACCAAGAATCTTGCCCTTCCGCCGAGAGAATCATCGCTAAAGCTATCACAGAAACCTACAACGCCAGACCTAGCATAGCTCCGTCTCTCATCCGCCTCCTATTTCACGATTGC
TTTATCGAG
GGATGTGATGCATCAGTCCTTCTAGACGCAGATGAATCTCTAACTTCTGAGAAAGAAGCATCTCCGAACCAGTCTTTGAAAGGGCTTGATGTGATTGACGCAATTAAGTCT
GAGCTAGAGAACGTCTGTCCTGGAGTTGTTTCCTGCGCCGACATTATTGTCTTGGCTGCTAGAGAAGCCGTCCTTTTG
GCTGGTGGTCCATTTTATCCACTGGAGACTGGAAGGAAAGAT
AGTGTAGCGGCCTTCAAGGAAATTGCAGAACGAGAGCTTCCAACACCACAAGCTAATCTCTCGGTAATTCTTGCAAGGTTTGCTTCCAGAGGATTCAACGAGAGAGAAACCGTCAGTTTA
TTCG
GAGCACACAGCATAGGCACTACGCACTGCACATTCTTTGAGGACCGGCTATACAACTTCGCAGGAACGGGGAAGCCTGACCCTGAACTCAATCCAGGGTTCCTCCAAGAACTGAAA
ACCAAATGCCCCTTCTCTGCCTCGGCTTCATCTCCATCACCATCCCCTGGCACTGGTTTAGCACCTTCCTTACCTGCATCAGATTGTCCCAAGAACTATGGTATGAGCCCAACAGGCGGG
AATGATGGAGTGATCGACTTGAGCTTCAACAATGAAGGAGGTGAGGAGAATTTCGGAACACGCTACTTCAGAAGATTGATGCAGAAGAAAGGGTTGTTGTTTTCTGATCAGCAGCTAACG
AGCAGTGAAGAGACTGAGACATGGGTGAGAGCCTATGCTTCAGATCCACAGTTGTTCCGACGTGACTTTGCCATGTCGATGATGAAGTTATCAAGTTACCATGTCTTGACTGGTCCTCTA
GGTCAAGTCAGAACAACATGCTCAAAGGTCCTGCCCAAGGAACTGATTTGA

Retrieve as FASTA