Entry information : TsPrx46 (Thhalv10025685m)
Entry ID 9822
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-22 (Christophe Dunand)
Peroxidase information: TsPrx46 (Thhalv10025685m)
Name (synonym) TsPrx46 (Thhalv10025685m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx46
start..stop
S start..stop
AtPrx46 576 0 6..330 3..326
CagraPrx26 560 0 6..330 3..327
AhalPrx48 553 0 6..330 3..326
BstrPrx22 550 0 6..330 3..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3505939..3506169 231 N° 2 3506281..3506460 180 N° 3 3506746..3506911 166 N° 4 3507003..3507418 416
join(3505939..3506169,3506281..3506460,3506746..3506911,3507003..3507418)


exon

Literature and cross-references TsPrx46 (Thhalv10025685m)
DNA ref. Phytozome 12:   scaffold_1 (3505939..3507418)
Protein sequence: TsPrx46 (Thhalv10025685m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   35792.59 Transmb domain:   %s   i12-29o
PI (pH):   %s   4.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTVASYRINYSYLLNLLVFLSSFLTASSDLSFNFYAASCPVAEFLVRNTVRSASSSDPTIPGKLLRLLFHDCFVQGCDASVLIQGNSTERSDPGNASLGGFSVIERAKNAIEIFCPATVSCADIVALAARDAVEAAGGPVVEIPTGRRDGKVSVAADVRPNIIDTDFSLDKMIDAFSSKGLSIQDLVVLSGAHTIGASHCNAFDGRFKRDPKGNLELIDASLDNSYAETLMNKCSSSSSSSSLTVSNDPETSSRFDNQYYKNLEAHKGLFQTDSALMEDERTRKMVEDLASDEESFFQRWRESFVKLSMVGVRFGEDGEIRRSCSSVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCAACGGTTGCCTCTTACCGAATAAACTATTCCTATCTTCTTAATCTCCTTGTGTTTCTGTCTAGCTTTCTCACTGCCTCTTCCGACCTCTCTTTTAACTTCTACGCCGCTTCT
TGTCCAGTAGCAGAGTTTCTCGTCAGAAACACCGTTAGATCTGCTTCCTCTTCCGATCCAACTATCCCCGGGAAACTCCTCCGTCTCCTCTTCCACGACTGTTTCGTCCAG
GTATAAACA
CGCACACTCACTACGCATCTCAATCATTACAATTTTTCAAGATGTTACAGAGGAAAACAAAAAATTTGAGCTGAGAATTCTGTTGTTGTTGCAACTTGCAAGGGTTGTGATGCGTCAGTG
TTGATACAAGGGAATAGCACGGAGAGAAGCGATCCAGGAAACGCGTCACTTGGAGGATTCTCAGTCATAGAGAGAGCTAAGAATGCCATCGAGATTTTCTGTCCGGCCACTGTTTCATGC
GCTGACATCGTCGCACTTGCTGCTCGAGACGCCGTCGAAGCT
GTAACATTCTCCCCCACTCTCACTTCACTCTCTTTCTATCTTGTATATCGCTCCAATTCGGTTTAACCAATCTGAACT
GAACCGAAACCATATAAAACAAAAAGGGAATAATCTGAAACGTCAAATAGAAAACAGAACATAAACCAAGATCACCGGATGTACAATTCCAGTTTTTTTCTATATAATTTATCCAAACCA
AAGAGAACCGGATTGGAAAATACATTAAACCGACGATAAACCGGTTATACTAATAAATGTGAATTTTTGTTTCTTTTGGTGGGAAAGGCGGGAGGACCGGTGGTTGAGATTCCGACAGGG
AGGAGAGACGGGAAAGTGTCGGTGGCTGCAGACGTAAGACCGAACATAATTGACACAGACTTCAGTCTTGACAAAATGATCGATGCCTTCTCCTCTAAAGGCTTGTCGATTCAAGATCTC
GTCGTTCTCTCTG
GTATCAAATGTTTCTTTGATATATCTCTGTAAAATAATCAATTTCACCAAAATGTTTTGGATAAGCTCAAATAAAATATAATTTGCATCAGGAGCACACACGATTGG
GGCTTCCCACTGTAATGCATTCGATGGAAGGTTTAAACGAGACCCGAAAGGAAACTTAGAGCTAATCGATGCGTCTCTCGACAACTCCTACGCAGAGACACTAATGAACAAGTGTTCATC
GTCATCGTCTTCGTCTTCACTGACGGTGAGCAACGATCCAGAGACATCGTCGAGGTTCGATAATCAGTACTACAAGAATCTGGAAGCGCACAAGGGTTTGTTCCAGACGGATTCTGCTCT
GATGGAGGATGAACGGACGAGGAAGATGGTGGAGGATCTGGCGAGTGATGAGGAAAGCTTTTTTCAGAGATGGAGAGAGTCGTTTGTGAAGCTGAGTATGGTTGGTGTCAGATTTGGTGA
AGATGGTGAAATAAGGCGCTCTTGTTCTTCCGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCAACGGTTGCCTCTTACCGAATAAACTATTCCTATCTTCTTAATCTCCTTGTGTTTCTGTCTAGCTTTCTCACTGCCTCTTCCGACCTCTCTTTTAACTTCTACGCCGCTTCT
TGTCCAGTAGCAGAGTTTCTCGTCAGAAACACCGTTAGATCTGCTTCCTCTTCCGATCCAACTATCCCCGGGAAACTCCTCCGTCTCCTCTTCCACGACTGTTTCGTCCAG
GGTTGTGAT
GCGTCAGTGTTGATACAAGGGAATAGCACGGAGAGAAGCGATCCAGGAAACGCGTCACTTGGAGGATTCTCAGTCATAGAGAGAGCTAAGAATGCCATCGAGATTTTCTGTCCGGCCACT
GTTTCATGCGCTGACATCGTCGCACTTGCTGCTCGAGACGCCGTCGAAGCT
GCGGGAGGACCGGTGGTTGAGATTCCGACAGGGAGGAGAGACGGGAAAGTGTCGGTGGCTGCAGACGTA
AGACCGAACATAATTGACACAGACTTCAGTCTTGACAAAATGATCGATGCCTTCTCCTCTAAAGGCTTGTCGATTCAAGATCTCGTCGTTCTCTCTG
GAGCACACACGATTGGGGCTTCC
CACTGTAATGCATTCGATGGAAGGTTTAAACGAGACCCGAAAGGAAACTTAGAGCTAATCGATGCGTCTCTCGACAACTCCTACGCAGAGACACTAATGAACAAGTGTTCATCGTCATCG
TCTTCGTCTTCACTGACGGTGAGCAACGATCCAGAGACATCGTCGAGGTTCGATAATCAGTACTACAAGAATCTGGAAGCGCACAAGGGTTTGTTCCAGACGGATTCTGCTCTGATGGAG
GATGAACGGACGAGGAAGATGGTGGAGGATCTGGCGAGTGATGAGGAAAGCTTTTTTCAGAGATGGAGAGAGTCGTTTGTGAAGCTGAGTATGGTTGGTGTCAGATTTGGTGAAGATGGT
GAAATAAGGCGCTCTTGTTCTTCCGTTAATTAA

Retrieve as FASTA