Entry information : TsPrx42(Thhalv10025680m)
Entry ID 9825
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2019-02-26 (Christophe Dunand)
Peroxidase information: TsPrx42(Thhalv10025680m)
Name TsPrx42(Thhalv10025680m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx42
start..stop
S start..stop
ThPrx42 689 0 1..331 1..331
BrPrx42_other 684 0 1..331 1..331
BoPrx42_other 684 0 1..331 1..331
BnPrx42_other 684 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7765613..7765843 231 N° 2 7766047..7766235 189 N° 3 7766363..7766528 166 N° 4 7766804..7767213 410
join(7765613..7765843,7766047..7766235,7766363..7766528,7766804..7767213)


exon

Literature and cross-references TsPrx42(Thhalv10025680m)
Literature Wong,C.E., Li,Y., Whitty,B., Diaz-Camino,C., Akhter,S.R., Brandle ,J., Golding,G.B., Weretinylk,E.A., Moffatt,B.A. and Griffith,M.
Expressed Sequence Tags from the Yukon Ecotype of Thellungiella salsuginea Reveal Little Overlap in Gene Expression in Response to Cold, Drought and High Salinity
Unpublished (2004)
DNA ref. Phytozome 12:   scaffold_1 (7765613..7767213)
EST ref. GenBank:   DN776782.1
Protein sequence: TsPrx42(Thhalv10025680m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (308)
PWM (Da):   %s   37448.11 (35018.9)  
PI (pH):   %s   7.78 (7.82) Peptide Signal:   %s   cut: 24 range:24-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGKGAMMVAILCLWALSATSEAVVTEEEPGLMMNFYKDTCPQAEDIIREQVKLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRELGEKEHDRSFGLRNFRYIEEIKEALERECPGVVSCSDILVLSAREGIEAVGGPHIPMKTGRRDGRKSRTDMLESYLPDHNESISVVLEKFKSIGIDTPGLVALLGSHSVGRTHCVKLVHRLYPEVDPSLNPDHVPHMLHKCPDSIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLLVDHQLAHDKRTRPIVKKMAKDQAYFFKEFTRAIQILSENNPLTGSKGEIRKQCNLANKIH*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 24 ESTs (DN776782, DN777747, DN777640, DN772810, DN776724, DN778369, DN772786, DN778424, DN778596, DN776189, DN776105, DN775413, DN776953, DN778435, DN778720, DN775847, DN778426, DN776248, DN775746, DN775590, DN776251, DN775562, DN773336, DN774498.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CACACTTGGA TCCGAAATTT GCTTTTATAA GTCTGGTGAA AAAAAATTAA CGTCTTTTCT TTTGTCTTGG CATTGAATCT TGCAGGCCCC ATGGTTGATG TAACGTCAAG GGCACGGATG  AGTACAGTTT CCACGTGTCA ATTCCATACA CTGAAATTGG ATTCTTCTAC TTAACCGATA ATAATAATGG TACCGGTTAT CATAATGTTC TGTTCAACAT ATGACATCTC TACACAGTTA  CTCGTCATTA ATTTGTTAGT TAGAACTTGT AAATCAGTGT TTAGCGCACA CATGTTAAGT GGAGTCCACT GAGCTAGAGA GTGACATTAC AGTGTGGCCC CTACAGTGCT ATTTGGCGAA  CACTTGGATA AGGGAACAAA AGTGTCGGTG GTCACAATAT TTCCATTTTT GTTTTAATGA AAATGTTCAG AATTTTTTTA CGTGAATACT GAATATACGA ATTCAGTGTA ATATTGGTAA  CACAGATACT TCTTTATCCT TCTATGAATT TCTTAAAAAA TAGGTATACT GTCCTCTCAT TTTATAGAGC CGTTACTATA TTTTACCTCT TTTCGTATTA CCAAAACTAG TGAATTCGAT  TCACTCTAAT CAAAATAAGT TCTGTAGATG CTGAAAAAGG AGAAATATAG TAGTCCCCAC TAAAAAACTA ATAGGAGGCC TTTAGCTTTT GGCGCACCGG TTATCATCAA AGAAATATAA  AGTGTTATTT GTATAAATTT GAAAAAATTT GTAGGTTGGA TTTTTTTTAG TTTAATTGTG AACCTTGGCC CTTGAATTTA GATAAAATTA TACTACTCAA CACTATTCTA AATTGTCCTA  TGAACTAGTG ACATAAATCA AATTTAACCT AATAAGTTAT TTTTTTTTTT TAAAAAAGTG AACACTCAAT AGTGATGTGT TGTGAACGAG TTTTAAACTT GGAACAGCTC ATCTCGAGAT  TCAAGATGAA ATCAATATTT GAGACGACTT TACAATGCAT AAGCCTCTCT ACTGACAATC CCTTATTACA TTTAGTAAAT TAATTGAATA GATAAATAAT TTCAGAAGAA AAAGTAATTG  AATATGTCCA ACTGGAATCA TAACTTAGAT TAAATATTCG AACTCAGCTT GTAAAGGATA AGAATCCACC TTGACTTCAT CGAAATGAAA GATTCCCTGA TATAAAGGAG CGGTTTAGCC  GCTGTATCGA CAATAATGAA CATTTCAGAT AATTACAACT CAACCCGTTA ACGTTTTTTA CTTTAGCTAT CACACCCCAT ATATCACAGT TGTTACAGCC GCCCCCTTTG TATTAACAAC  AAAACAAGCA GATTTTTTCA TAGGGTCCAC TCATACACTC ATAGAGACCA AAAAACAAAA CTTGGTGATT GGTTTAGCTA ACGAAAACAC CCTTCTAGAT GAGATAAACC ACCCAAAATG  CCATCCACTT TAAATCTCCA ACAAACTTAT TTATTGTCTC ATAGGCACTG TGTACGGCGT AGTGTAAGTC ATCTAGTATT AGTAACAAGT GTGGTTTTTA GATTTCTTAC CCAGATTATC  TTTTCATAAC AATGTATGAT ATACATTTAA ATCTAAAATA TAAAAGACGG ACGATGAGCC GATGACCGAA TATGTAAGTT TAATTTATTA TTAAGAAAAT GACGGATAGG ACAGAGACAT  ACAATTATTG TAGGGTAATC AATTATAATA ATCTTTTTGG TTTCTCAATA GTTAAAAACG AATAATTTAT AAACTAGAGC TTAATAGTCT TTTAGTATAT GATATAATCA CAAAAATGTA  TTCGTAGAAA CGTGGAAGCT TCACCTACCT GCATTAGTTT ACTGTAATCT CCAAATTAAA CCTTTAGTTT TACTGAAAAA ATAAATAAAG AAGAAAACAG TATTTCCTTT ATTTAAGGAC 
GCTGCATTGC TTGCTCAGTG ACTCAACTCA AGAGTGGTGT TGTGTGAGAG AGAGAAGAAG AAGGAGAAAG ATAAAAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGAAAAGGTGCGATGATGGTGGCGATACTCTGCCTTTGGGCACTCTCTGCAACATCAGAAGCAGTTGTAACAGAGGAGGAGCCCGGCTTGATGATGAACTTCTACAAGGACACG
TGTCCTCAGGCCGAAGACATCATCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTTTCTTGGCTCCGTAACATCTTCCACGACTGCGCCGTGGAG
GTCCCAACT
CTCTCTCTCTCTCTTACTCTCTCTCTGTCTCTAGATCTCTCTTTCTCTCAATGATATTTCATGTTTTGCGTGATGGGATAGGATTTCTTGGATGATTTTAGTGGAAAAGTACCAATCGTT
GTGTAAAACATAGCTTAAGGTTAGAACTTTTTACTTGAAACAGAGCTAAAGATTAACTCTGTTTTGTAATACAGTCATGCGATGCGTCGCTTTTGCTTGATTCCACAAGAAGAGAGCTAG
GAGAGAAAGAACACGACAGGAGCTTCGGTCTGAGAAACTTCAGGTACATAGAGGAGATCAAGGAAGCTCTTGAGAGGGAGTGCCCTGGTGTTGTCTCTTGTTCCGACATTCTCGTCTTGT
CCGCAAGAGAAGGCATTGAAGCA
GTAAGTTAAAAACAAGTCGTGCTGTTTCTTTCCCTTGTTACGAAACTGCGTATTGTTGTTTTTTTTTTTTTTTTTTCTGTGGGATGTTTTTATTAAG
TGTGTGTGTGTGTGGGATATTGTTTTGTAGGTGGGAGGACCGCATATTCCGATGAAGACAGGAAGGAGAGATGGACGTAAAAGCAGGACTGATATGCTTGAGTCTTATCTTCCCGACCAC
AACGAGAGTATCTCTGTAGTTCTTGAAAAGTTCAAATCCATCGGAATCGACACTCCCGGCCTCGTCGCTCTCCTCG
GTACATTATTCTTTCTCCTCCTGAACTATCTCTCACTAGTCTCC
GTGCAAAACGTATCGCTTGAAAGTCAAAACTCTTGACCACCCAAGAAATTATTTACATATTCCAATACAAGGGTATTATCGTCAATTTTGACTCATGCATGAAAACACTCTTAGGAAGAT
TAGTGAAACGACTTGAGCTAGTCTTGTCGGCTCGCATCGGAGTATGCGATCTGAGTCGGATAAGTTGGATATTATAAGATTTTGACTTTTTTTGTTATGACACGTGCGCAGGATCTCACA
GCGTGGGAAGAACTCATTGTGTTAAGCTGGTGCACCGTTTGTACCCTGAGGTTGATCCGTCTTTGAACCCGGACCACGTTCCTCACATGCTTCACAAGTGTCCTGACTCGATCCCTGACC
CAAAAGCGGTCCAGTACGTGCGTAACGACCGTGGTACGCCCATGGTGCTAGACAACAACTACTACCGTAACATCCTGGACAACAAGGGTTTGCTCCTTGTGGACCACCAGCTCGCACACG
ACAAACGGACCAGACCAATTGTTAAGAAGATGGCTAAGGACCAGGCTTACTTCTTCAAGGAGTTCACTAGAGCGATCCAGATCTTGTCTGAGAACAATCCTTTGACTGGTTCCAAGGGTG
AGATCAGGAAACAGTGTAATCTGGCCAACAAGATCCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGAAAAGGTGCGATGATGGTGGCGATACTCTGCCTTTGGGCACTCTCTGCAACATCAGAAGCAGTTGTAACAGAGGAGGAGCCCGGCTTGATGATGAACTTCTACAAGGACACG
TGTCCTCAGGCCGAAGACATCATCCGTGAACAAGTCAAACTCCTCTACAAACGCCACAAGAACACCGCTTTTTCTTGGCTCCGTAACATCTTCCACGACTGCGCCGTGGAG
TCATGCGAT
GCGTCGCTTTTGCTTGATTCCACAAGAAGAGAGCTAGGAGAGAAAGAACACGACAGGAGCTTCGGTCTGAGAAACTTCAGGTACATAGAGGAGATCAAGGAAGCTCTTGAGAGGGAGTGC
CCTGGTGTTGTCTCTTGTTCCGACATTCTCGTCTTGTCCGCAAGAGAAGGCATTGAAGCA
GTGGGAGGACCGCATATTCCGATGAAGACAGGAAGGAGAGATGGACGTAAAAGCAGGACT
GATATGCTTGAGTCTTATCTTCCCGACCACAACGAGAGTATCTCTGTAGTTCTTGAAAAGTTCAAATCCATCGGAATCGACACTCCCGGCCTCGTCGCTCTCCTCG
GATCTCACAGCGTG
GGAAGAACTCATTGTGTTAAGCTGGTGCACCGTTTGTACCCTGAGGTTGATCCGTCTTTGAACCCGGACCACGTTCCTCACATGCTTCACAAGTGTCCTGACTCGATCCCTGACCCAAAA
GCGGTCCAGTACGTGCGTAACGACCGTGGTACGCCCATGGTGCTAGACAACAACTACTACCGTAACATCCTGGACAACAAGGGTTTGCTCCTTGTGGACCACCAGCTCGCACACGACAAA
CGGACCAGACCAATTGTTAAGAAGATGGCTAAGGACCAGGCTTACTTCTTCAAGGAGTTCACTAGAGCGATCCAGATCTTGTCTGAGAACAATCCTTTGACTGGTTCCAAGGGTGAGATC
AGGAAACAGTGTAATCTGGCCAACAAGATCCACTGA

Retrieve as FASTA