Entry information : TsPrx43 (Thhalv10025604m)
Entry ID 9828
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-22 (Christophe Dunand)
Peroxidase information: TsPrx43 (Thhalv10025604m)
Name (synonym) TsPrx43 (Thhalv10025604m)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx43
start..stop
S start..stop
CagraPrx52 615 0 1..326 1..326
BrPrx43-1Aa_other 610 0 1..326 1..326
BnPrx43_other 608 0 1..326 1..326
AtPrx43 607 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5990210..5990422 213 N° 2 5989955..5990137 183 N° 3 5989701..5989863 163 N° 4 5988473..5988894 422
complement(join(5988473..5988894,5989701..5989863,5989955..5990137,5990210..5990 422))


exon

Literature and cross-references TsPrx43 (Thhalv10025604m)
DNA ref. Phytozome 12:   scaffold_1 (5990422..5988473)
Protein sequence: TsPrx43 (Thhalv10025604m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   35301.12 (32668.7)  
PI (pH):   %s   6.36 (6.05) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVWTKTNSSLALSLVTVFLGVSLADLKVGFYSSTCPQAESIVRRVVFGAALSDPNLPAILLRLHFHDCFVEGCDGSILVDNGAISEKNAFGHEGVRGFEIVETAKAELEAACPGVVSCSDIVALAARDAISLANGPAYEVPTGRRDGRVSNMSLAKDMPDVSDSIEILKAKFMQKGLNAKELVLLSAAHTIGTTACFFMTKRLYEFLPGGQPDPTINPVFLPELTTRCPQNGDINTRVPMDRFSERIFDKQILQNIKDGFAVLQTDAGLYEDAMTRRVVDSYIGLLNPLLGPSFESDFVKAIVKMGKIHVKTGSKGEVRRVCSAFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (An extra sequence after 'FHDC' ). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTGGACAAAGACTAATAGTAGTCTAGCGTTGTCTCTGGTCACGGTTTTCCTTGGCGTCTCTCTAGCTGATCTAAAAGTCGGCTTTTACTCCAGTACATGCCCTCAAGCCGAGTCA
ATCGTTAGAAGAGTCGTCTTTGGAGCTGCTCTTTCCGACCCTAACCTTCCGGCTATACTTCTGCGGCTCCATTTCCATGACTGCTTTGTCGAG
GTAAGATGCACTTTCCTCCTCTTTTTG
CTTATTGTTGCATTTTTCAGAAGATTCAACAACACACACGTGCAGGGATGTGACGGGTCGATCCTCGTGGACAACGGAGCAATCTCTGAAAAGAATGCATTCGGGCATGAAGGCGTCAGA
GGATTTGAGATAGTAGAAACCGCCAAAGCCGAGCTTGAAGCTGCATGCCCAGGTGTTGTCTCGTGCTCAGACATTGTTGCCTTGGCTGCACGTGATGCAATATCTTTG
GTAAAAAATATA
AAATTCAAAAAGAAAGAGAAAAGAAAACCTTTCGATCTTTCTCTATTTTCTTCTCCGTTGTGATCAATTCATCGTACAGGCGAATGGACCGGCGTATGAGGTTCCAACTGGGCGGAGAGA
CGGTCGGGTTTCGAACATGTCGCTGGCTAAGGACATGCCGGATGTGAGTGACTCGATTGAGATACTTAAGGCTAAGTTCATGCAGAAAGGTCTCAACGCCAAAGAACTCGTCCTTCTCAG
TG
GTATGTATCCCTCTCCCTCTTTCTTCTCTTTTCTCTCTCATTCATGTTTGTTTAGTGGTCTCGAATCTCTCGAGGTTTTTGGTACGAAGTCCAAGTTATATGAGTTCTCATTTCCTAC
ACCCGTGATGTGTTTCGCATGTGTTGTCCGTTTCTTCTTTTCTTCGTGCTGATGCCACGTGACTACTCCGTGCGTTAAGCCTTCCGTGCGTTAGGCCTACCGTGCGTTACCAAATTCTCG
TAGACCACCTTTTTTCTTGTATCTACACAAAAAAATTATGGGATTTTTCTAGCTAAGCCAGCAGTTTTATTTTTTTGCTAAGAAAATTTTTTCATGACAATTTGTGAATTCAATCAAACA
GTTGATCCCATTTTACCTATACTTTGCTAAATATTTCTTTAAAAATGATCTGTTTAAAGAAAACAGAGTGAGTTTTATATTTTAGGCATTTTAACAACTTACGTTAGGCATTGATTAAAG
GATATTTTAGGAAGAAATGTTTTGATTTTCTGTCATCTTATCCATTAAATCTGGAGTGGCGCAGAAATATAGGCAGCTTATCTGACCAAAATGCATTCCGTCATAATTATTTTATAATGG
GGCCACTCTTACGAGTTTCGAGTGGATTTTGTGTCAAATTATGGGACAGTAAAATTGTCATCTCCGTGTGACCCCCCAAAAAAAAATATCAACATGCACAAGTCTAATACAGTAGGCTAC
TGACAGTAGCTCAAGATCACCAGCACCATTCAACACTTGAGTGATCCACTTTCCATTCGTCCTAATAAATTATTTTGTACCTTATCAGCTGCTCACACTATCGGGACAACGGCCTGCTTT
TTTATGACTAAACGCCTCTACGAGTTCTTACCTGGTGGCCAGCCCGACCCGACCATCAATCCGGTATTCTTACCCGAACTAACCACTCGGTGCCCACAAAACGGTGACATAAACACCCGG
GTTCCAATGGACCGGTTCAGTGAACGGATATTCGACAAGCAGATTCTGCAGAATATAAAGGATGGTTTTGCCGTGCTTCAGACTGACGCGGGACTCTACGAGGATGCAATGACCCGCCGG
GTAGTGGATTCCTATATTGGGTTGCTAAATCCACTACTTGGCCCATCGTTCGAATCCGATTTCGTAAAGGCAATAGTGAAGATGGGGAAGATTCATGTGAAAACTGGTTCTAAAGGAGAG
GTTCGACGGGTTTGCTCGGCTTTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGTGGACAAAGACTAATAGTAGTCTAGCGTTGTCTCTGGTCACGGTTTTCCTTGGCGTCTCTCTAGCTGATCTAAAAGTCGGCTTTTACTCCAGTACATGCCCTCAAGCCGAGTCA
ATCGTTAGAAGAGTCGTCTTTGGAGCTGCTCTTTCCGACCCTAACCTTCCGGCTATACTTCTGCGGCTCCATTTCCATGACTGCTTTGTCGAG
GGATGTGACGGGTCGATCCTCGTGGAC
AACGGAGCAATCTCTGAAAAGAATGCATTCGGGCATGAAGGCGTCAGAGGATTTGAGATAGTAGAAACCGCCAAAGCCGAGCTTGAAGCTGCATGCCCAGGTGTTGTCTCGTGCTCAGAC
ATTGTTGCCTTGGCTGCACGTGATGCAATATCTTTG
GCGAATGGACCGGCGTATGAGGTTCCAACTGGGCGGAGAGACGGTCGGGTTTCGAACATGTCGCTGGCTAAGGACATGCCGGAT
GTGAGTGACTCGATTGAGATACTTAAGGCTAAGTTCATGCAGAAAGGTCTCAACGCCAAAGAACTCGTCCTTCTCAGTG
CTGCTCACACTATCGGGACAACGGCCTGCTTTTTTATGACT
AAACGCCTCTACGAGTTCTTACCTGGTGGCCAGCCCGACCCGACCATCAATCCGGTATTCTTACCCGAACTAACCACTCGGTGCCCACAAAACGGTGACATAAACACCCGGGTTCCAATG
GACCGGTTCAGTGAACGGATATTCGACAAGCAGATTCTGCAGAATATAAAGGATGGTTTTGCCGTGCTTCAGACTGACGCGGGACTCTACGAGGATGCAATGACCCGCCGGGTAGTGGAT
TCCTATATTGGGTTGCTAAATCCACTACTTGGCCCATCGTTCGAATCCGATTTCGTAAAGGCAATAGTGAAGATGGGGAAGATTCATGTGAAAACTGGTTCTAAAGGAGAGGTTCGACGG
GTTTGCTCGGCTTTCAATTGA

Retrieve as FASTA