Entry information : TsPrx40 (Thhalv10025534m)
Entry ID 9829
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-10-22 (Christophe Dunand)
Peroxidase information: TsPrx40 (Thhalv10025534m)
Name (synonym) TsPrx40 (Thhalv10025534m)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx40
start..stop
S start..stop
BstrPrx61 677 0 1..363 1..362
AlyPrx40 672 0 1..363 1..362
AhalPrx40 665 0 1..363 1..362
CagraPrx20 647 0 16..363 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10808286..10808615 330 N° 2 10807932..10808123 192 N° 3 10807672..10807837 166 N° 4 10807161..10807564 404
complement(join(10807161..10807564,10807672..10807837,10807932..10808123,1080828 6..10808615))


exon

Literature and cross-references TsPrx40 (Thhalv10025534m)
DNA ref. Phytozome 12:   scaffold_1 (10808615..10807161)
Protein sequence: TsPrx40 (Thhalv10025534m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364
PWM (Da):   %s   38972.3 Transmb domain:   %s   i13-35o
PI (pH):   %s   4.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLKLENKVERDHITIMKMLFNLFVMLFASMPILSLSENPTNFSETCEDGSGETGSGFGIGFGLVLDFGLYKNSCPEAESIVYSSVETAVLQDPRMAASLLRLHFHDCFVNGCDASVLLDDTEGLVGEKTAPPNLNSLRGFEVIDSIKSDLESVCPETVSCADILVMAARDSVVVSGGPSWEVEVGRKDGRTASKQAATNGLPSPNSTVPTLISIFQKLGLSQTDMVALSGGHTLGKAKCTSFTARLLPLQTGQPANNGDNLEFLESLQQLCSTVDPAVGITQLDLVTPSTFDNQYYVNLLSGEGLLPSDQALAVQDPRTREIVETYAADQSVFFNDFKNAMVKMGGISGGNEGEIRRNCRTVN*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGAAACTCGAGAACAAAGTGGAGAGAGATCATATAACCATCATGAAGATGCTCTTTAACTTATTTGTTATGCTTTTCGCTTCAATGCCAATTCTCTCACTCTCCGAGAATCCAACC
AACTTCAGCGAGACTTGTGAAGACGGAAGTGGAGAAACCGGTTCAGGTTTCGGTATAGGATTCGGTTTGGTTCTTGATTTCGGTTTATACAAGAATAGCTGCCCTGAAGCAGAGTCTATC
GTCTACTCTTCAGTCGAGACAGCGGTTTTACAGGATCCAAGAATGGCGGCTTCTCTTCTCCGTCTTCATTTCCACGACTGTTTTGTCAAT
GCAAGTCTTCTCATCTTAATTTCGTTTTGA
TTGTTTCATAAATAATCCCCTCTCTTTTACAAATCATTGAACCGGAAAACTATTAACCAATTAATTATGCAGAAGTACCGGTTCAGTAGAGCAAAAGTATGAACCGGGATGTGTTTTTGA
CTTGCATTGCAGGGATGTGATGCTTCGGTGTTATTGGATGACACAGAAGGATTGGTTGGTGAGAAAACGGCGCCTCCCAATCTAAATTCTCTACGAGGATTCGAGGTGATAGATTCGATA
AAGTCTGATCTTGAATCTGTATGCCCAGAGACTGTCTCATGCGCAGATATTCTTGTCATGGCTGCTAGAGATTCAGTCGTTGTG
GTAAACCGGATTCCTAATCATGCTCTTATGTATAAA
CCGGATGGAAATAATTTAAACCAGTTTTAACTGAACACTTTAACTCGGGGTTTTGAAGTCGGGTGGACCAAGCTGGGAGGTGGAAGTAGGAAGAAAAGACGGTAGAACCGCTAGTAAACA
AGCAGCAACAAATGGCTTACCATCACCAAACTCAACTGTGCCAACTCTCATCTCTATCTTTCAAAAGCTCGGCCTTTCGCAAACCGACATGGTCGCTCTTTCCG
GTACACTACTGTCTCT
AGTAATTCTTCTTTCTCTTAACCTAAACCAACCGGTTTTTAGCAGAAACAGAGGATAATCACAATCACACTTAACACCAATGTAAAACCAGGTGGGCATACATTGGGAAAGGCAAAATGC
ACATCGTTCACAGCTCGGTTGCTGCCACTACAAACCGGACAACCGGCTAACAACGGAGACAACCTTGAGTTCCTCGAGTCGCTACAGCAACTGTGCTCGACCGTTGACCCTGCCGTAGGT
ATCACTCAGCTTGACTTGGTGACACCGTCAACATTTGACAACCAGTACTATGTTAACCTCCTCTCTGGTGAGGGATTGCTTCCATCGGACCAAGCTTTGGCGGTTCAGGACCCAAGGACA
AGGGAGATTGTTGAGACCTACGCAGCGGATCAGTCGGTTTTCTTCAATGATTTCAAGAATGCCATGGTTAAAATGGGAGGGATAAGTGGTGGTAATGAGGGAGAGATTAGGAGGAATTGT
AGAACGGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGAAACTCGAGAACAAAGTGGAGAGAGATCATATAACCATCATGAAGATGCTCTTTAACTTATTTGTTATGCTTTTCGCTTCAATGCCAATTCTCTCACTCTCCGAGAATCCAACC
AACTTCAGCGAGACTTGTGAAGACGGAAGTGGAGAAACCGGTTCAGGTTTCGGTATAGGATTCGGTTTGGTTCTTGATTTCGGTTTATACAAGAATAGCTGCCCTGAAGCAGAGTCTATC
GTCTACTCTTCAGTCGAGACAGCGGTTTTACAGGATCCAAGAATGGCGGCTTCTCTTCTCCGTCTTCATTTCCACGACTGTTTTGTCAAT
GGATGTGATGCTTCGGTGTTATTGGATGAC
ACAGAAGGATTGGTTGGTGAGAAAACGGCGCCTCCCAATCTAAATTCTCTACGAGGATTCGAGGTGATAGATTCGATAAAGTCTGATCTTGAATCTGTATGCCCAGAGACTGTCTCATGC
GCAGATATTCTTGTCATGGCTGCTAGAGATTCAGTCGTTGTG
TCGGGTGGACCAAGCTGGGAGGTGGAAGTAGGAAGAAAAGACGGTAGAACCGCTAGTAAACAAGCAGCAACAAATGGC
TTACCATCACCAAACTCAACTGTGCCAACTCTCATCTCTATCTTTCAAAAGCTCGGCCTTTCGCAAACCGACATGGTCGCTCTTTCCG
GTGGGCATACATTGGGAAAGGCAAAATGCACA
TCGTTCACAGCTCGGTTGCTGCCACTACAAACCGGACAACCGGCTAACAACGGAGACAACCTTGAGTTCCTCGAGTCGCTACAGCAACTGTGCTCGACCGTTGACCCTGCCGTAGGTATC
ACTCAGCTTGACTTGGTGACACCGTCAACATTTGACAACCAGTACTATGTTAACCTCCTCTCTGGTGAGGGATTGCTTCCATCGGACCAAGCTTTGGCGGTTCAGGACCCAAGGACAAGG
GAGATTGTTGAGACCTACGCAGCGGATCAGTCGGTTTTCTTCAATGATTTCAAGAATGCCATGGTTAAAATGGGAGGGATAAGTGGTGGTAATGAGGGAGAGATTAGGAGGAATTGTAGA
ACGGTTAACTAA

Retrieve as FASTA