Entry information : AdelCIIBA12
Entry ID 9833
Creation 2011-11-22 (Christophe Dunand)
Last sequence changes 2011-11-22 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2017-03-13 (Catherine Mathe)
Peroxidase information: AdelCIIBA12
Name AdelCIIBA12
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA12
start..stop
S start..stop
AdelCIIBA13 524 0 14..347 24..358
AdelCIIBA15 462 1e-164 16..347 22..352
AdelCIIBA16 443 3e-157 16..344 22..349
AdelCIIBA01 424 8e-150 12..347 10..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 331716..331805 90 N° 2 331570..331660 91 N° 3 331347..331521 175 N° 4 331199..331274 76
N° 5 331070..331129 60 N° 6 330700..331014 315 N° 7 330555..330647 93 N° 8 330427..330501 75
N° 9 330305..330373 69  
complement(join(330305..330373,330427..330501,330555..330647,330700..331014,3310 70..331129,331199..331274,331347..331521,331570..331660,331716..331805))


exon

Literature and cross-references AdelCIIBA12
DNA ref. JGI genome:   scaffold_11 (331805..330305)
Protein sequence: AdelCIIBA12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347
PWM (Da):   %s   36235.22  
PI (pH):   %s   4.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPYITPLIAAPALDTRALCPDGVNRVNNLQCCRFIPVRDALISEIFEGQCGENAHSTVRIAFHDAIGFSTRGGKGGGADGSMIAFGATELAFAANAGIDEIVEDLQPFADAHGVSYGDIIQFGSSVALSLCPGAPLVQTFVGRNATAPAPDGTVPDPFNPVTQILARMADAGFSPAEVIALLASHSIAAQDEIEPNIARSPFDSTPDSFDTQVFLEVLLKGNVLPGGLGPGEGEVLSPLEGEFRLESDAAFARDPRTACTWQSFVANQSLMSRQFATAMAKLGLLGQNSRQLVDCTEIIPRAKPATRTAAIIPAGKTRQDIEASCAQSAFPNLQTARGPPATVPPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTACATTACTCCTCTCATAGCTGCCCCCGCGCTAGACACCCGCGCACTGTGCCCTGATGGTGTGAACCGCGTCAACAACCTTCAGGTTTGTCCCCGTCATCACTGCTTATGTAAG
CTGAGCGCTCATGGGATCTGCGTAGTGCTGCCGCTTCATCCCCGTCCGCGACGCGCTGATCTCAGAGATCTTTGAGGGGCAGTGCGGCGAGAACGCTCACTCCACCGTTCGCATCGGTAC
GCGAATCTCCCTGAAACTAGGGCACGACCTGACTTTCCATTCAGCCTTCCACGATGCCATCGGCTTCAGCACCAGGGGTGGCAAGGGTGGAGGCGCCGACGGCTCCATGATCGCCTTCGG
CGCGACTGAGCTCGCGTTCGCCGCCAACGCGGGTATTGACGAAATCGTGGAGGATCTGCAGCCGTTCGCTGACGCGCACGGTGTTTCATACGGCGATAT
GTGCGCTTACCTCTCTCTTTT
GCATCTATCAATGTTATAGCTTGCAATGCTGATGCATGATCTAATATGCAGCATCCAATTCGGCTCCTCTGTTGCGCTCTCGCTGTGCCCCGGCGCTCCGCTGGTGCAAACCTTCGTCGG
CCGCAGG
GTTCGTGCCATATATCCGCGCTGCCCTTCGCCTTCGCGGCTTCTCACCAACAACGTCCTGCTATTCCAGAATGCCACTGCGCCGGCCCCTGATGGCACCGTGCCTGACCCGTT
CAACCCTGTCACTCAG
GTTTGCAGGAACCCATCGCGACCGTAGACGCGCTCGGCTGATATAAGAATGTTAGATCCTTGCTCGCATGGCTGATGCTGGGTTCTCTCCGGCCGAGGTCATCG
CCCTCCTGGCGAGTCACTCTATCGCCGCTCAGGACGAGATTGAGCCCAATATTGCGCGCTCCCCCTTTGACTCGACGCCAGACAGTTTCGACACGCAGGTGTTCCTGGAAGTCCTCCTGA
AGGGCAACGTCCTGCCGGGCGGCCTCGGCCCCGGCGAAGGCGAAGTGTTGAGCCCGCTCGAGGGCGAGTTCCGTCTCGAATCTGACGCCGCCTTCGCGCGCGACCCAAGGACTGCTTGCA
CCTGGCAGAGCTTCGTCGCGAACCAG
GTGCGCGTTCTCCGGGCGCAATGACATCAGCGGAAGGTCTGACTCGCGCAAGTCCTTGATGTCTAGGCAGTTTGCCACGGCCATGGCCAAGCTG
GGTCTGCTCGGCCAGAACAGCCGCCAGCTGGTCGACTGCACCGAGATCATT
GTGCGTGGTCTAGTCCTCGTGCCCCTGCCGCCGCCGTGCTCACATGTGCACAGCCTCGCGCAAAGCCAG
CTACCCGGACTGCGGCCATAATCCCCGCGGGTAAGACGCGTCAGGACATTGAGGCCTCC
GTAAGCCATCTGTTTCATACTGGCACCCGGGCTGTGGCTCACACCACGCTTAGTGCGCACA
GAGCGCATTCCCGAACCTGCAGACCGCCCGCGGTCCGCCGGCCACCGTTCCTCCCGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTACATTACTCCTCTCATAGCTGCCCCCGCGCTAGACACCCGCGCACTGTGCCCTGATGGTGTGAACCGCGTCAACAACCTTCAGTGCTGCCGCTTCATCCCCGTCCGCGACGCG
CTGATCTCAGAGATCTTTGAGGGGCAGTGCGGCGAGAACGCTCACTCCACCGTTCGCATCG
CCTTCCACGATGCCATCGGCTTCAGCACCAGGGGTGGCAAGGGTGGAGGCGCCGACGGC
TCCATGATCGCCTTCGGCGCGACTGAGCTCGCGTTCGCCGCCAACGCGGGTATTGACGAAATCGTGGAGGATCTGCAGCCGTTCGCTGACGCGCACGGTGTTTCATACGGCGATAT
CATC
CAATTCGGCTCCTCTGTTGCGCTCTCGCTGTGCCCCGGCGCTCCGCTGGTGCAAACCTTCGTCGGCCGCAGG
AATGCCACTGCGCCGGCCCCTGATGGCACCGTGCCTGACCCGTTCAAC
CCTGTCACTCAG
ATCCTTGCTCGCATGGCTGATGCTGGGTTCTCTCCGGCCGAGGTCATCGCCCTCCTGGCGAGTCACTCTATCGCCGCTCAGGACGAGATTGAGCCCAATATTGCGCGC
TCCCCCTTTGACTCGACGCCAGACAGTTTCGACACGCAGGTGTTCCTGGAAGTCCTCCTGAAGGGCAACGTCCTGCCGGGCGGCCTCGGCCCCGGCGAAGGCGAAGTGTTGAGCCCGCTC
GAGGGCGAGTTCCGTCTCGAATCTGACGCCGCCTTCGCGCGCGACCCAAGGACTGCTTGCACCTGGCAGAGCTTCGTCGCGAACCAG
TCCTTGATGTCTAGGCAGTTTGCCACGGCCATG
GCCAAGCTGGGTCTGCTCGGCCAGAACAGCCGCCAGCTGGTCGACTGCACCGAGATCATT
CCTCGCGCAAAGCCAGCTACCCGGACTGCGGCCATAATCCCCGCGGGTAAGACGCGTCAG
GACATTGAGGCCTCC
TGCGCACAGAGCGCATTCCCGAACCTGCAGACCGCCCGCGGTCCGCCGGCCACCGTTCCTCCCGTGTAA

Retrieve as FASTA