Entry information : PmGPx01
Entry ID 9838
Creation 2011-11-22 (Passaia Gisèle)
Last sequence changes 2011-11-23 (Christophe Dunand)
Sequence status N/D
Reviewer Not yet reviewed
Last annotation changes 2011-11-23 (Christophe Dunand)
Peroxidase information: PmGPx01
Name PmGPx01
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: Gpx3001]
Taxonomy Eukaryota Fungi Ascomycota Eurotiomycetes Trichocomaceae Penicillium
Organism Penicillium marneffei    [TaxId: 37727 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PmGPx01
start..stop
S start..stop
TstGPx01 332 2e-118 1..170 1..170
AclGPx 278 5e-97 1..171 1..171
AfumGPx 279 8e-97 1..171 45..215
TrubrGPx01 276 3e-96 1..170 1..170
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 859..901 43 N° 2 235..785 551  
complement(join(235..785,859..901))


exon

Literature and cross-references PmGPx01
Protein ref. GenBank:   XP_002152894.1
DNA ref. GenBank:   NW_002196667.1 (1842820..1841613)
mRNA ref. GenBank:   XM_002152858
Protein sequence: PmGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   197
PWM (Da):   %s   21246.95  
PI (pH):   %s   7.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASATTFYDFSPPDKKGNPYPLTDYKGKVVLVVNTASKCGFTPQFAGLEKLYKSIEAKHPGAFTILGFPCNQFGNQDPGSNDEIQSFCQVNYGVTFPVLGKIDVNGSKAEPLFEWIKSEKPGLLGVKRVLWNFEKALINGKGEVVGRWRSITKPESLEATILKEIDIASKDVKGVEVVPTATETAASAAPAEEAKEA

Retrieve as FASTA  
Remarks complete sequence from genomic (1 intron). No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCGCGACCACGTTCTACGACTTTTCTCCTCCTGACAGTGCGTCGTCTCCTCTTCCCCTCCCAAATATCCGATTCCTTACTTCGCGAAAGTACTAATGAAGAGCGAACAGAAAA
AGGAAACCCTTACCCCTTGACAGACTACAAGGGCAAAGTCGTCCTCGTCGTCAACACAGCATCCAAATGCGGCTTCACGCCCCAATTCGCCGGCCTTGAAAAACTCTACAAATCTATCGA
AGCCAAGCATCCCGGCGCCTTCACCATCCTGGGTTTTCCCTGCAATCAGTTCGGAAACCAAGATCCCGGAAGCAACGACGAAATCCAGAGCTTTTGCCAGGTTAATTATGGCGTTACGTT
CCCCGTACTGGGAAAGATTGATGTGAATGGGAGTAAAGCGGAGCCGTTGTTTGAATGGATCAAGAGCGAGAAGCCGGGACTACTGGGCGTGAAGAGGGTGTTGTGGAATTTTGAGAAAGC
CTTGATCAATGGCAAGGGTGAAGTTGTGGGGAGGTGGAGGAGCATTACCAAACCAGAAAGTTTGGAGGCGACGATTTTGAAGGAGATTGATATTGCGAGTAAGGATGTGAAGGGTGTGGA
GGTTGTGCCTACGGCGACGGAGACTGCTGCTTCTGCTGCGCCGGCGGAGGAAGCTAAGGAGGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCGCGACCACGTTCTACGACTTTTCTCCTCCTGACAAAAAAGGAAACCCTTACCCCTTGACAGACTACAAGGGCAAAGTCGTCCTCGTCGTCAACACAGCATCCAAATGCGGC
TTCACGCCCCAATTCGCCGGCCTTGAAAAACTCTACAAATCTATCGAAGCCAAGCATCCCGGCGCCTTCACCATCCTGGGTTTTCCCTGCAATCAGTTCGGAAACCAAGATCCCGGAAGC
AACGACGAAATCCAGAGCTTTTGCCAGGTTAATTATGGCGTTACGTTCCCCGTACTGGGAAAGATTGATGTGAATGGGAGTAAAGCGGAGCCGTTGTTTGAATGGATCAAGAGCGAGAAG
CCGGGACTACTGGGCGTGAAGAGGGTGTTGTGGAATTTTGAGAAAGCCTTGATCAATGGCAAGGGTGAAGTTGTGGGGAGGTGGAGGAGCATTACCAAACCAGAAAGTTTGGAGGCGACG
ATTTTGAAGGAGATTGATATTGCGAGTAAGGATGTGAAGGGTGTGGAGGTTGTGCCTACGGCGACGGAGACTGCTGCTTCTGCTGCGCCGGCGGAGGAAGCTAAGGAGGCTTGA

Retrieve as FASTA