Entry information : TviGPx01
Entry ID 9841
Creation 2011-11-23 (Passaia Gisèle)
Last sequence changes 2011-11-28 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2013-09-06 (Catherine Mathe (Scipio))
Peroxidase information: TviGPx01
Name TviGPx01
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: Gpx3001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Hypocreaceae Hypocrea
Organism Trichoderma virens    [TaxId: 29875 ]
Cellular localisation N/D
Tissue type N/D
Inducer Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value TviGPx01
start..stop
S start..stop
TaspGPx01 395 3e-141 5..255 5..263
TatGPx01 372 6e-132 5..255 5..262
TharGPx01 350 1e-124 86..255 1..170
HjGPx01 336 6e-118 30..255 21..263
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 632214..632511 298 N° 2 631591..632057 467  
complement(join(631591..632057,632214..632511))


exon

Literature and cross-references TviGPx01
DNA ref. JGI genome:   scaffold_2 (632511..631591)
EST ref. GenBank:   FG380082.1 [3' end]
Protein sequence: TviGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   255
PWM (Da):   %s   28561.46  
PI (pH):   %s   9.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHFANSKFTSRVLGRALLGPNPRSCDTGRFEAIRRAPLVAKRHQWTDLRSRSLYSGAVRPGASTCTLHQHRIQSTASCDRLYSTMSSATNFFDFTVLDAADTEVPLSNYKGKVVLVVNTASKCGFTYQYKNLESVYQAIKKEYPDDFTVIGFPCNQFGGQEPGSNEEIQNFCSLDQKTTFPVMAKINVNGNDAHPLYQWLKHEKPGLLGLERIKWNFEKFLIGRDGKVIDRWASTTEPEKFQSKIIEAIKAPA

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron) and 4 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCATTTTGCAAATTCCAAATTCACATCCCGCGTGCTGGGCCGGGCGCTGCTGGGCCCGAACCCTCGGAGCTGTGACACAGGCCGTTTTGAAGCAATCCGCCGAGCGCCGCTAGTA
GCAAAACGTCACCAGTGGACTGACTTGAGGAGTCGCTCTTTATATTCTGGCGCGGTCCGTCCTGGAGCCTCGACTTGCACTCTGCATCAACACCGCATCCAGTCCACAGCTTCTTGCGAC
AGACTCTATTCCACAATGTCTTCTGCCACCAACTTCTTCGACTTCACGGTGCTCGACG
GTAAGCTCGACATTCCCTCCAACCCCCCCCGAGCCCCTCCATCCCCGTCGCCCAGCTTTGCG
CCGATAGCTATCACCCCGCTATTGCGCCAGACACAACGCCCATGATAGTAGCAGCCCGGAGACTTTTCCCGCTAACGAGCACGCTTTCTTACAGCCGCCGACACCGAAGTCCCTCTGTCC
AACTACAAGGGCAAGGTCGTCTTGGTTGTCAACACGGCTTCCAAGTGCGGCTTCACCTACCAGTACAAGAACCTCGAGTCCGTCTACCAGGCCATCAAGAAGGAGTACCCTGATGACTTC
ACCGTCATCGGCTTCCCCTGCAACCAGTTTGGCGGCCAAGAGCCCGGCAGCAACGAGGAGATCCAGAACTTCTGCTCGCTGGACCAGAAGACTACCTTCCCCGTCATGGCCAAGATTAAC
GTCAACGGCAACGATGCGCACCCCCTGTACCAGTGGCTGAAGCACGAGAAGCCCGGCCTTCTTGGTCTAGAGAGAATCAAGTGGAACTTTGAGAAGTTCCTGATCGGCCGTGACGGCAAG
GTTATCGACCGCTGGGCCAGCACCACCGAGCCGGAGAAGTTTCAGAGCAAGATCATCGAGGCCATCAAGGCGCCAGCCCCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCCATTTTGCAAATTCCAAATTCACATCCCGCGTGCTGGGCCGGGCGCTGCTGGGCCCGAACCCTCGGAGCTGTGACACAGGCCGTTTTGAAGCAATCCGCCGAGCGCCGCTAGTA
GCAAAACGTCACCAGTGGACTGACTTGAGGAGTCGCTCTTTATATTCTGGCGCGGTCCGTCCTGGAGCCTCGACTTGCACTCTGCATCAACACCGCATCCAGTCCACAGCTTCTTGCGAC
AGACTCTATTCCACAATGTCTTCTGCCACCAACTTCTTCGACTTCACGGTGCTCGACG
CCGCCGACACCGAAGTCCCTCTGTCCAACTACAAGGGCAAGGTCGTCTTGGTTGTCAACACG
GCTTCCAAGTGCGGCTTCACCTACCAGTACAAGAACCTCGAGTCCGTCTACCAGGCCATCAAGAAGGAGTACCCTGATGACTTCACCGTCATCGGCTTCCCCTGCAACCAGTTTGGCGGC
CAAGAGCCCGGCAGCAACGAGGAGATCCAGAACTTCTGCTCGCTGGACCAGAAGACTACCTTCCCCGTCATGGCCAAGATTAACGTCAACGGCAACGATGCGCACCCCCTGTACCAGTGG
CTGAAGCACGAGAAGCCCGGCCTTCTTGGTCTAGAGAGAATCAAGTGGAACTTTGAGAAGTTCCTGATCGGCCGTGACGGCAAGGTTATCGACCGCTGGGCCAGCACCACCGAGCCGGAG
AAGTTTCAGAGCAAGATCATCGAGGCCATCAAGGCGCCAGCCCCA

Retrieve as FASTA