Entry information : PoCIIBA02_PC15 (MnP-short)
Entry ID 9843
Creation 2011-11-25 (Christophe Dunand)
Last sequence changes 2011-11-25 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-08-22 (Nizar Fawal)
Peroxidase information: PoCIIBA02_PC15 (MnP-short)
Name (synonym) PoCIIBA02_PC15 (MnP-short)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoCIIBA02_PC15
start..stop
S start..stop
PoCIIBA02_C9 729 0 1..360 1..360
PoCIIBA01_PC15 559 0 1..360 1..358
PoCIIBA01_C9 559 0 1..360 1..358
ParcCIIBA04 531 0 20..360 21..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2770353..2770466 114 N° 2 2770235..2770298 64 N° 3 2770160..2770176 17 N° 4 2770086..2770094 9
N° 5 2769977..2770035 59 N° 6 2769869..2769924 56 N° 7 2769738..2769816 79 N° 8 2769444..2769684 241
N° 9 2769331..2769384 54 N° 10 2769129..2769273 145 N° 11 2768903..2769078 176 N° 12 2768778..2768846 69
complement(join(2768778..2768846,2768903..2769078,2769129..2769273,2769331..2769 384,2769444..2769684,2769738..2769816,2769869..2769924,2769977..2770035,2770086. .2770094,2770160..2770176,2770235..2770298,2770353..2770466))


exon

Literature and cross-references PoCIIBA02_PC15 (MnP-short)
DNA ref. JGI genome:   scaffold_05 (2770466..2768778)
Protein sequence: PoCIIBA02_PC15 (MnP-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (342)
PWM (Da):   %s   38067.1 (36114.0)  
PI (pH):   %s   4.74 (4.67) Peptide Signal:   %s   cut: 19 range:19-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFKALFTFATLAVAALAAPSHTKRATCSGGRTTAHASCCIWFDVLDDIQENLFDGGECGEEVHSLRLTFHDAIGFSPKLFLQGKFGGLGADGSIMAHSEIETAPANLGVDEIIEAQRPFAIKHKVSFGDFIQFAGAVGVSNCAGGARIPFHAGRLNVSLPSPDLLVPEPSDSVDTILARMGDAGFSPNEVVDLLISHTVAAQDNVDPTIGTPFDSTPNSFDAQFFVETLLKGSITPGNGTNRGQSLSPIPGEFRLTSDFLLARDARTACEWQSFITDHASMVSKFEKVMDKMSTLGQIRALLTDCSDVIPVPKVALTKTPTLPAGRSLADIEACRATPFPALTADPGPVTTVPPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAAGGCTCTATTCACTTTCGCCACTCTCGCTGTAGCGGCCCTCGCTGCTCCTAGCCACACCAAGCGCGCCACATGCTCGGGCGGCAGGACCACTGCTCATGCATCCGTAGGT
GCTTTGCCCATCATGCTATGACTTCGTTGCTAACAGTGTCCGCGTCAGTGCTGCATCTGGTTCGACGTTTTGGACGACATTCAAGAGAACCTCTTTGATGGTGGCGAGTGCGGTAAGTAG
CTTGCGATCACCATGCGCATGGCCTGTTCTCAAGTTTACATTGACTGCAGGTGAGGAAGTCCACGAGGTAATAACAATGGATCCTATGCATGGTGAACAATACTGATCTGAGACCAACGC
AACGTTCTGCAGTCTCTCCGTGTAAGGATTATTGACTCGCTCCATCCCACATCGCTGACCCACTATATTAGTTGACCTTCCACGACGCTATTGGATTCTCCCCTAAGCTCTTCCTCCAAG
GCAAATTTGG
GTAAGTGACGCAAGGTTCCTGCCTCTTCGAAGAGTCTCTGAACTTCAAACAGTGGTCTCGGCGCTGATGGTTCCATCATGGCCCACTCTGAGATCGAAACCGCCTTCCGT
AAGTGTTCTACTCATCAGAACAAGAATACACAATCTCAATTCCCTCAAAGCCGCCAATCTTGGTGTCGATGAGATCATTGAAGCTCAAAGGCCGTTTGCCATCAAGCACAAAGTATCTTT
CGGTGACTT
GTACGTGCATCTTGTGATCGTGCGGAGCTGGTGTTTATACGCATTGCCATCAGCATCCAATTCGCTGGTGCCGTCGGTGTTAGCAACTGCGCTGGTGGTGCTCGCATTCCT
TTCCACGCCGGACGTCTCAACGTCTCTTTGCCCTCGCCAGACCTCCTCGTCCCCGAACCTAGCGACTCTGTTGACACCATCTTGGCCCGCATGGGCGATGCTGGCTTCTCCCCTAACGAA
GTAGTTGATTTGCTCATCTCTCACACCGTCGCTGCTCAGGACAACGTTGACCCCACTATTCCC
GTAAGCAATCATTGCAAATTCTTACCAGTTCCTATTGCATCCTAACAATCGGCGTAC
AGGGAACTCCCTTCGACTCTACTCCCAACAGCTTCGACGCTCAGTTCTTCGTCGAGGTTCGCAAAAATCTACTAGTACCTAGTCCGCAAAAGTACTAATCGGGGGATCTGTAGACTCTCC
TCAAGGGAAGCATCACCCCCGGAAACGGAACTAACCGAGGCCAATCCCTCTCTCCCATCCCGGGCGAGTTCCGCCTTACTTCTGACTTCCTTCTTGCCCGCGATGCCCGCACTGCTTGCG
AATGGCAATCCTTCATCA
GTGAGTCAGAGTTCCCTCCACCTTCGCCTATATATTGACCCACTTGCCAGCCGACCACGCCTCCATGGTCTCGAAATTCGAGAAGGTCATGGACAAGATGTC
CACTCTAGGCCAAATCCGAGCTCTCCTCACTGACTGCTCCGACGTTATTCCTGTGCCCAAGGTCGCCCTCACCAAGACCCCTACCCTCCCAGCTGGGCGCAGCTTGGCTGATATTGAGGC
CGCA
GTAAGTTGTTTTGCCTTGTGGGCGTTTTCTCTCTATCTGACCATCGTGTACAATAGTGCCGCGCCACGCCATTCCCAGCCCTCACTGCTGACCCTGGCCCAGTTACCACCGTTCCT
CCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTTCAAGGCTCTATTCACTTTCGCCACTCTCGCTGTAGCGGCCCTCGCTGCTCCTAGCCACACCAAGCGCGCCACATGCTCGGGCGGCAGGACCACTGCTCATGCATCCTGCTGC
ATCTGGTTCGACGTTTTGGACGACATTCAAGAGAACCTCTTTGATGGTGGCGAGTGCG
GTGAGGAAGTCCACGAGTCTCTCCGTTTGACCTTCCACGACGCTATTGGATTCTCCCCTAAG
CTCTTCCTCCAAGGCAAATTTGG
TGGTCTCGGCGCTGATGGTTCCATCATGGCCCACTCTGAGATCGAAACCGCCTTCCCCGCCAATCTTGGTGTCGATGAGATCATTGAAGCTCAAAGG
CCGTTTGCCATCAAGCACAAAGTATCTTTCGGTGACTT
CATCCAATTCGCTGGTGCCGTCGGTGTTAGCAACTGCGCTGGTGGTGCTCGCATTCCTTTCCACGCCGGACGTCTCAACGTC
TCTTTGCCCTCGCCAGACCTCCTCGTCCCCGAACCTAGCGACTCTGTTGACACCATCTTGGCCCGCATGGGCGATGCTGGCTTCTCCCCTAACGAAGTAGTTGATTTGCTCATCTCTCAC
ACCGTCGCTGCTCAGGACAACGTTGACCCCACTATTCCC
GGAACTCCCTTCGACTCTACTCCCAACAGCTTCGACGCTCAGTTCTTCGTCGAGACTCTCCTCAAGGGAAGCATCACCCCC
GGAAACGGAACTAACCGAGGCCAATCCCTCTCTCCCATCCCGGGCGAGTTCCGCCTTACTTCTGACTTCCTTCTTGCCCGCGATGCCCGCACTGCTTGCGAATGGCAATCCTTCATCA
CC
GACCACGCCTCCATGGTCTCGAAATTCGAGAAGGTCATGGACAAGATGTCCACTCTAGGCCAAATCCGAGCTCTCCTCACTGACTGCTCCGACGTTATTCCTGTGCCCAAGGTCGCCCTC
ACCAAGACCCCTACCCTCCCAGCTGGGCGCAGCTTGGCTGATATTGAGGCCGCA
TGCCGCGCCACGCCATTCCCAGCCCTCACTGCTGACCCTGGCCCAGTTACCACCGTTCCTCCTGTG
TAA

Retrieve as FASTA