Entry information : PtrGPx01
Entry ID 9850
Creation 2011-12-01 (Passaia Gisèle)
Last sequence changes 2011-12-01 (Passaia Gisèle)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-20 (Christophe Dunand)
Peroxidase information: PtrGPx01
Name PtrGPx01
Class Fungi-Bacteria glutathione peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Bacillariophyta Bacillariophyceae Phaeodactylaceae Phaeodactylum
Organism Phaeodactylum tricornutum    [TaxId: 2850 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtrGPx01
start..stop
S start..stop
TpsGPx03 110 2e-28 124..344 29..283
AtGPx04 80 3e-18 203..344 4..167
TaGPx06-1A 78 2e-17 203..346 6..171
AlyGPx04 78 2e-17 203..344 4..167
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..61 61 N° 2 105..250 146 N° 3 590..1090 501 N° 4 1139..1474 336
join(1..61,105..250,590..1090,1139..1474)


exon

Literature and cross-references PtrGPx01
Literature Bowler C et al (2008) The Phaeodactylum genome reveals the evolutionary history of diatom genomes. Nature 456:239–244
DNA ref. JGI genome:   chr_11 (477413..479292)
Protein sequence: PtrGPx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347
PWM (Da):   %s   39274.65 Transmb domain:   %s   i148-165o
PI (pH):   %s   5.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTKAKPFVEPSHEGICGEHECEPYNPGAGGWPTIRYFNAETGKSGKPYTQKTKKAMCQELGEMDYMIAPNPTLDEVGCEPRRNCSQNRVELDRENTFANRSQVNHAPSKDKIIDMLLWIPKAPKSCDDDEKAAKLQRQARARAQKTINFLGLLCVLFFLAITQLDDRAARTPDSGLRSRTSDAARIELLENVERDEFLGKKSPSLPDDSIYNLEYPDSLGETISLKRFAGQITLVLAVLHEDLQAKGFSVLAFPSNDFHQELETNEEIHRFWQQEFPEATFPVFAESSLRDNPIYQCLRNQLPGKEVRQNFFKYLVGRDGLAIDLFTKMQDPETLRSSIEELLAAL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chr_11, 3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAAAAGCAAAGCCCTTCGTGGAACCAAGTCACGAAGGCATTTGCGGGGAACACGAATGTTCGTTTTGCAGACATTAACCTTAAAGAAACGCCTATTAGAGGCGAGCCCTACAATCC
CGGTGCGGGTGGCTGGCCAACTATTCGATACTTTAATGCCGAAACTGGTAAGAGCGGCAAGCCCTACACTCAGAAGACGAAAAAGGCGATGTGCCAAGAACTGGGCGAGATGGATTACAT
GATTGCTTAT
GTTGAAGAAGCAGGAAGTACATTGCTGGACTCGAACATGCAAGCAATAGAGCTGTAAAAAGGTTTTCAACTGTGGTGACTAGTTTCTGAAACGGAAAGAGGTGAATGACA
TGGCGAATAGTTCCAGATATGGACAGTTGTCGTCGAAAAATGAGCCTACATGCATTTCCATGTTTTGACAGTAAGCGTTCCCCGCCTGCCTCAAAACGAATGCATTGAGCTTGTCCTCTA
TCACTACAGTTACTAAATCCGATTCAACAAAGTTGTCTTATCCCTTTATTTCATTCGTGTTAGCTTTTGTCGTCGTTTGTTTTGATCATGGTTTGACGGTGAAAAACAGCCGAACCCCAC
CCTAGATGAAGTTGGTTGCGAGCCGAGGCGGAATTGCAGCCAGAACAGGGTCGAATTGGATCGGGAAAATACCTTTGCAAATAGAAGCCAAGTCAACCACGCTCCTTCGAAAGACAAGAT
CATAGACATGCTTTTATGGATACCAAAGGCCCCAAAGAGCTGCGATGACGATGAAAAGGCGGCAAAGCTGCAGCGACAGGCGCGAGCTCGTGCGCAAAAAACCATCAATTTTCTCGGATT
ATTATGCGTACTATTTTTCCTTGCCATAACTCAACTAGACGATCGCGCTGCGCGGACACCAGACTCTGGTCTCCGATCCCGAACATCTGATGCAGCGCGTATTGAGCTTCTGGAGAATGT
GGAGCGGGACGAATTCTTGGGGAAAAAATCGCCATCGCTTCCAGACGATTCAATATACAATCTCGAATACCCGGATTCTTTGGGTGAGACGATATCTTTGAAGCGGTTTGCTGGCCAAAT
AACACTCGTT
GTGAACACAGCAAGCAAGTGAGGCAAAACTAAACTGGAGTACCATCAGCTGGCGGTGCTTCACGAAGATTTGCAGGCGAAGGGATTTTCTGTACTGGCATTTCCATCGAA
CGATTTTCACCAAGAGCTCGAAACGAACGAAGAGATTCACAGGTTTTGGCAACAAGAATTTCCGGAAGCGACCTTTCCTGTTTTCGCCGAAAGTTCACTGCGTGATAACCCGATTTATCA
GTGTCTTCGGAACCAGCTTCCAGGCAAAGAGGTGCGGCAAAATTTTTTTAAGTACCTTGTTGGGCGAGATGGATTAGCTATCGACCTCTTCACCAAAATGCAAGATCCAGAGACACTCCG
GTCTTCAATAGAAGAGCTTCTCGCGGCTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAAAAGCAAAGCCCTTCGTGGAACCAAGTCACGAAGGCATTTGCGGGGAACACGAATGCGAGCCCTACAATCCCGGTGCGGGTGGCTGGCCAACTATTCGATACTTTAATGCCGAA
ACTGGTAAGAGCGGCAAGCCCTACACTCAGAAGACGAAAAAGGCGATGTGCCAAGAACTGGGCGAGATGGATTACATGATTGCTTAT
CCGAACCCCACCCTAGATGAAGTTGGTTGCGAG
CCGAGGCGGAATTGCAGCCAGAACAGGGTCGAATTGGATCGGGAAAATACCTTTGCAAATAGAAGCCAAGTCAACCACGCTCCTTCGAAAGACAAGATCATAGACATGCTTTTATGGATA
CCAAAGGCCCCAAAGAGCTGCGATGACGATGAAAAGGCGGCAAAGCTGCAGCGACAGGCGCGAGCTCGTGCGCAAAAAACCATCAATTTTCTCGGATTATTATGCGTACTATTTTTCCTT
GCCATAACTCAACTAGACGATCGCGCTGCGCGGACACCAGACTCTGGTCTCCGATCCCGAACATCTGATGCAGCGCGTATTGAGCTTCTGGAGAATGTGGAGCGGGACGAATTCTTGGGG
AAAAAATCGCCATCGCTTCCAGACGATTCAATATACAATCTCGAATACCCGGATTCTTTGGGTGAGACGATATCTTTGAAGCGGTTTGCTGGCCAAATAACACTCGTT
CTGGCGGTGCTT
CACGAAGATTTGCAGGCGAAGGGATTTTCTGTACTGGCATTTCCATCGAACGATTTTCACCAAGAGCTCGAAACGAACGAAGAGATTCACAGGTTTTGGCAACAAGAATTTCCGGAAGCG
ACCTTTCCTGTTTTCGCCGAAAGTTCACTGCGTGATAACCCGATTTATCAGTGTCTTCGGAACCAGCTTCCAGGCAAAGAGGTGCGGCAAAATTTTTTTAAGTACCTTGTTGGGCGAGAT
GGATTAGCTATCGACCTCTTCACCAAAATGCAAGATCCAGAGACACTCCGGTCTTCAATAGAAGAGCTTCTCGCGGCTTTGTAA

Retrieve as FASTA