Entry information : TvDyPrx01 (DyP1)
Entry ID 9852
Creation 2011-12-02 (Christophe Dunand)
Last sequence changes 2012-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-02 (Christophe Dunand)
Peroxidase information: TvDyPrx01 (DyP1)
Name (synonym) TvDyPrx01 (DyP1)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvDyPrx01
start..stop
S start..stop
TvDyPrx01_other 889 0 1..485 1..486
CsuDyPrx01 650 0 1..484 1..481
DsDyPrx 615 0 1..484 1..483
GsppDyPrx02 611 0 1..484 1..489
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2126633..2126685 53 N° 2 2126344..2126581 238 N° 3 2125986..2126287 302 N° 4 2125637..2125932 296
N° 5 2125298..2125574 277 N° 6 2125183..2125244 62 N° 7 2124895..2125124 230  
complement(join(2124895..2125124,2125183..2125244,2125298..2125574,2125637..2125 932,2125986..2126287,2126344..2126581,2126633..2126685))


exon

Literature and cross-references TvDyPrx01 (DyP1)
DNA ref. JGI genome:   scaffold_7 (2126685..2124895)
Protein sequence: TvDyPrx01 (DyP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   485
PWM (Da):   %s   52068.78  
PI (pH):   %s   5.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSTVPAFDPANVQGDILVGLPKKAQQYIIFQIDDNVTGFRKALNNLIPLITTTTQVQQDRTKIANNKKAAKEQGKTPALIKLSGVNVAFSQAGLTLGITDDLLDPAFKEGQLADAQNLGDPGSTASGKFVPDWLPAFLQGNIHGVILISGDCNATIAETRVVIERIFSVGASNATLHEVTTLIGKVRPGLEDGHEHFGFLDGISQPAIEGIDTNPNPGQETVRQGIILLGRDGDGTTGRPSWAIDGSFLALRYLFQLVPEFNNFLKGNALTGNGLTPDQGSELLGARLMGRWKGAPIDLAPTQDDPALGADASRNNNFRYAFTDDQTTTIRCPFAAHTRKTNPRADLEDPPISFSTETRRIIRRGVQFGDEVTPQEAASGKTALDRGLIFAAYQSTIPNGFQFIQSWANTVSFPPNKPFTPGFDPIIGQTNDDSVRTLAGTDPNNQTAELSLPTDWVLPKGGEYFFSPSIPALRTKFALAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCACCGTCCCCGCTTTCGATCCCGCCAATGTTCAGGGCGATATTCTGTAAGGATCCGGCTTGACTCCATGTCGAGTAGGCTGCTGACTGTTGTCCAGTGTCGGTCTCCCCAAG
AAGGCCCAGCAGTACATCATCTTCCAGATTGATGACAACGTCACCGGCTTCAGGAAGGCCCTCAACAACCTCATCCCTCTGATCACCACGACCACCCAGGTACAGCAGGACCGCACCAAG
ATCGCCAACAACAAGAAGGCGGCGAAGGAGCAGGGCAAGACCCCCGCATTGATCAAGCTTTCCGGCGTGAACGTTGCGTTCTCCCAGGCTGGCTTGACGAAG
GTGCGGTGATCCATGTCC
TCACCCCGATACCCCTGCTCATTTGCTTGCAAATTTAGCTGGGAATTACCGATGACCTCCTCGACCCTGCGTTCAAAGAGGGCCAGCTGGCCGACGCTCAGAACCTGGGTGATCCGGGCT
CGACTGCGAGTGGCAAGTTCGTTCCCGACTGGCTCCCCGCCTTTTTGCAGGGCAACATCCACGGTGTGATCCTCATCTCGGGCGATTGCAATGCGACCATCGCCGAGACCCGTGTTGTGA
TCGAGCGCATCTTCAGCGTCGGCGCCTCCAACGCCACCCTCCATGAAGTGACCACGCTCATAGGCAAGGTTCGCCCCGGCCTCGAGGATGGCCACGAGCA
GTACGTCAGCTCTTCTCTCA
GATGTGGGGAACAGTTCTGATACGGCGGTACAGTTTCGGTTTCCTCGACGGTATCTCGCAGCCCGCGATCGAGGGCATTGACACGAACCCCAACCCCGGACAGGAGACTGTCCGCCAGGG
CATTATCCTCCTCGGCCGCGACGGTGACGGCACTACGGGCCGCCCTTCGTGGGCGATCGATGGCAGTTTCCTTGCCCTCCGTTACCTCTTCCAGCTGGTCCCGGAGTTCAACAACTTCCT
CAAGGGCAACGCCCTCACGGGCAACGGTCTCACGCCGGACCAGGGGAGTGAGCTCCTCGGCGCTCGCCTCATGGGCCGCTGGAAGAGCG
GTAAGGCATCCCACCCACGGGCCATTATCTG
TGTCGCTCTGTACTGAACCCTGTGTTCATAGGCGCGCCGATCGACCTTGCGCCCACTCAAGACGACCCCGCGTTGGGCGCGGACGCTTCCCGCAACAACAACTTCCGGTACGCCTTCACC
GATGACCAGACGACCACCATTCGTTGCCCCTTCGCGGCGCACACGCGCAAGACCAACCCTCGCGCGGATCTCGAGGACCCGCCGATCAGCTTTTCCACGGAGACGCGGCGCATCATCCGC
CGTGGTGTTCAGTTCGGTGATGAAGTGACTCCGCAAGAGGCGGCCTCCGGCAAGACGGCGCTCGACCG
GTATGCTTCTCTTTAAAAAAGTTCCACTTAGCGCATCTAAACTGTGATCCTA
GTGGCCTCATCTTCGCCGCATACCAGAGCACCATCCCGAACGGCTTCCAGTTCATTCAGAAGAGTGAGTGATCTATCGCAACCGTTCCCACAATGCAGCCATCTTACTCTCTTGCACCTA
GGCTGGGCGAACACCGTCAGCTTCCCCCCCAACAAGCCTTTCACCCCCGGTTTCGACCCCATCATCGGTCAGACCAACGACGACTCAGTGCGCACCCTCGCCGGCACGGACCCGAACAAC
CAGACCGCCGAGCTCTCGCTCCCCACGGACTGGGTTCTCCCCAAGGGCGGCGAGTACTTCTTCTCGCCCTCGATCCCGGCTCTGCGCACGAAGTTCGCGCTCGCGGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTCCACCGTCCCCGCTTTCGATCCCGCCAATGTTCAGGGCGATATTCTTGTCGGTCTCCCCAAGAAGGCCCAGCAGTACATCATCTTCCAGATTGATGACAACGTCACCGGCTTC
AGGAAGGCCCTCAACAACCTCATCCCTCTGATCACCACGACCACCCAGGTACAGCAGGACCGCACCAAGATCGCCAACAACAAGAAGGCGGCGAAGGAGCAGGGCAAGACCCCCGCATTG
ATCAAGCTTTCCGGCGTGAACGTTGCGTTCTCCCAGGCTGGCTTGACGAAG
CTGGGAATTACCGATGACCTCCTCGACCCTGCGTTCAAAGAGGGCCAGCTGGCCGACGCTCAGAACCTG
GGTGATCCGGGCTCGACTGCGAGTGGCAAGTTCGTTCCCGACTGGCTCCCCGCCTTTTTGCAGGGCAACATCCACGGTGTGATCCTCATCTCGGGCGATTGCAATGCGACCATCGCCGAG
ACCCGTGTTGTGATCGAGCGCATCTTCAGCGTCGGCGCCTCCAACGCCACCCTCCATGAAGTGACCACGCTCATAGGCAAGGTTCGCCCCGGCCTCGAGGATGGCCACGAGCA
TTTCGGT
TTCCTCGACGGTATCTCGCAGCCCGCGATCGAGGGCATTGACACGAACCCCAACCCCGGACAGGAGACTGTCCGCCAGGGCATTATCCTCCTCGGCCGCGACGGTGACGGCACTACGGGC
CGCCCTTCGTGGGCGATCGATGGCAGTTTCCTTGCCCTCCGTTACCTCTTCCAGCTGGTCCCGGAGTTCAACAACTTCCTCAAGGGCAACGCCCTCACGGGCAACGGTCTCACGCCGGAC
CAGGGGAGTGAGCTCCTCGGCGCTCGCCTCATGGGCCGCTGGAAGAGCG
GCGCGCCGATCGACCTTGCGCCCACTCAAGACGACCCCGCGTTGGGCGCGGACGCTTCCCGCAACAACAAC
TTCCGGTACGCCTTCACCGATGACCAGACGACCACCATTCGTTGCCCCTTCGCGGCGCACACGCGCAAGACCAACCCTCGCGCGGATCTCGAGGACCCGCCGATCAGCTTTTCCACGGAG
ACGCGGCGCATCATCCGCCGTGGTGTTCAGTTCGGTGATGAAGTGACTCCGCAAGAGGCGGCCTCCGGCAAGACGGCGCTCGACCG
TGGCCTCATCTTCGCCGCATACCAGAGCACCATC
CCGAACGGCTTCCAGTTCATTCAGAAGA
GCTGGGCGAACACCGTCAGCTTCCCCCCCAACAAGCCTTTCACCCCCGGTTTCGACCCCATCATCGGTCAGACCAACGACGACTCAGTGCGC
ACCCTCGCCGGCACGGACCCGAACAACCAGACCGCCGAGCTCTCGCTCCCCACGGACTGGGTTCTCCCCAAGGGCGGCGAGTACTTCTTCTCGCCCTCGATCCCGGCTCTGCGCACGAAG
TTCGCGCTCGCGGCTTGA

Retrieve as FASTA