Entry information : MgDyPrx
Entry ID 9856
Creation 2011-12-02 (Christophe Dunand)
Last sequence changes 2012-04-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-06-06 (Christophe Dunand)
Peroxidase information: MgDyPrx
Name MgDyPrx
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella graminicola (Septoria tritici)    [TaxId: 54734 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgDyPrx
start..stop
S start..stop
MpopDyPrx 313 7e-105 1..275 7..282
SpopDyPrx 315 4e-103 1..275 52..327
MpiDyPrx01 301 3e-100 1..276 6..287
BcomDyPrx 259 6e-84 1..276 8..269
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 50324..50587 264 N° 2 49971..50266 296 N° 3 49594..49912 319  
complement(join(49594..49912,49971..50266,50324..50587))


exon

Literature and cross-references MgDyPrx
DNA ref. JGI genome:   chr_3 (50587..49594)
Protein sequence: MgDyPrx
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   292
PWM (Da):   %s   32124.44  
PI (pH):   %s   6.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
DLTNVQGDILLDGLPKEVETFWFFDIVDATKFCKNLRVVANREISSTQDVREKRGEIKAFKQQGKAAGGLQVPTVGANISFSAKGLKKISPVVGLNLTTNDQDFEAGMRATAVDKLADPKSPMSSDPIWDPEWHGHEIHGVLLVAGNTPALVKEKLDRIVKLFDGSIKLAFKLDGQVRPGEQKGHEHFGYKDGVSQPAISNIPNLTQDEAFVPPGQDTIDQGAILCGRPGDTQASTRQPWMVDGSFLAFRKLKQNVQDWDKFLVDSSNILGTFSDHERCSRRRQSRNEGTFM

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GACCTCACCAATGTGCAAGGCGACATTCTCCTCGACGGTCTCCCCAAAGAGGTCGAGACCTTCTGGTTCTTCGACATCGTCGATGCCACCAAGTTCTGCAAGAACCTTCGCGTCGTGGCC
AACAGGGAGATTTCCAGCACGCAGGATGTGCGAGAGAAGCGTGGTGAGATCAAGGCTTTCAAGCAGCAGGGCAAAGCCGCGGGAGGATTGCAGGTTCCGACTGTTGGAGCGAATATTTCG
TTCTCGGCGAAGGGGTTGAAGAAG
GTGAGACCGACCAACGACCTGTGGTCTTGATTAAGCACGATGGTTGACACATCTCAGATCTCTCCTGTCGTCGGCCTCAACCTCACCACCAACGAC
CAAGACTTTGAAGCCGGCATGCGGGCCACTGCCGTCGATAAGCTGGCCGATCCCAAGTCTCCTATGAGCAGCGACCCCATCTGGGACCCGGAGTGGCATGGCCATGAGATCCACGGCGTA
CTGCTGGTGGCAGGGAACACGCCTGCTCTGGTGAAGGAGAAACTCGATCGCATCGTCAAGTTGTTCGACGGCTCGATCAAGTTGGCATTCAAGCTTGATGGACAAGTCAGACCGGGCGAG
CAGAAGGGACATGAGCA
GTAAGTCTCGTTCTCTTCAGCCTCACCAGCCATTGACAACGTCTAACTCCACATCCAGCTTCGGCTACAAAGACGGCGTCTCCCAACCCGCCATCTCCAATAT
TCCCAACCTCACCCAAGACGAGGCCTTCGTCCCACCCGGTCAAGACACAATCGACCAAGGCGCAATCCTCTGCGGCCGACCCGGCGACACTCAAGCCTCCACCCGTCAACCCTGGATGGT
TGATGGCAGCTTCCTCGCCTTCCGCAAACTGAAACAAAACGTTCAGGACTGGGACAAGTTCCTCGTCGACTCCTCCAACATATTGGGCACCTTCTCCGACCACGAGAGATGTTCGCGCAG
GCGCCAGTCACGCAACGAGGGGACTTTCATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GACCTCACCAATGTGCAAGGCGACATTCTCCTCGACGGTCTCCCCAAAGAGGTCGAGACCTTCTGGTTCTTCGACATCGTCGATGCCACCAAGTTCTGCAAGAACCTTCGCGTCGTGGCC
AACAGGGAGATTTCCAGCACGCAGGATGTGCGAGAGAAGCGTGGTGAGATCAAGGCTTTCAAGCAGCAGGGCAAAGCCGCGGGAGGATTGCAGGTTCCGACTGTTGGAGCGAATATTTCG
TTCTCGGCGAAGGGGTTGAAGAAG
ATCTCTCCTGTCGTCGGCCTCAACCTCACCACCAACGACCAAGACTTTGAAGCCGGCATGCGGGCCACTGCCGTCGATAAGCTGGCCGATCCCAAG
TCTCCTATGAGCAGCGACCCCATCTGGGACCCGGAGTGGCATGGCCATGAGATCCACGGCGTACTGCTGGTGGCAGGGAACACGCCTGCTCTGGTGAAGGAGAAACTCGATCGCATCGTC
AAGTTGTTCGACGGCTCGATCAAGTTGGCATTCAAGCTTGATGGACAAGTCAGACCGGGCGAGCAGAAGGGACATGAGCA
CTTCGGCTACAAAGACGGCGTCTCCCAACCCGCCATCTCC
AATATTCCCAACCTCACCCAAGACGAGGCCTTCGTCCCACCCGGTCAAGACACAATCGACCAAGGCGCAATCCTCTGCGGCCGACCCGGCGACACTCAAGCCTCCACCCGTCAACCCTGG
ATGGTTGATGGCAGCTTCCTCGCCTTCCGCAAACTGAAACAAAACGTTCAGGACTGGGACAAGTTCCTCGTCGACTCCTCCAACATATTGGGCACCTTCTCCGACCACGAGAGATGTTCG
CGCAGGCGCCAGTCACGCAACGAGGGGACTTTCATGTGA

Retrieve as FASTA