Entry information : GmAPx26 (Glyma1_01-PACid_16286786 / Glyma1_01-PACid_16286787)
Entry ID 9860
Creation 2011-11-29 (Qiang Li)
Last sequence changes 2014-11-21 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-06-26 (Christophe Dunand)
Peroxidase information: GmAPx26 (Glyma1_01-PACid_16286786 / Glyma1_01-PACid_16286787)
Name (synonym) GmAPx26 (Glyma1_01-PACid_16286786 / Glyma1_01-PACid_16286787)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmAPx26
start..stop
S start..stop
VuAPx01 489 1e-178 1..246 1..246
GmAPx01 482 5e-176 1..246 1..246
MtAPx01 477 8e-174 1..246 1..246
AhAPx01 468 2e-170 1..246 1..251
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5390187..5390305 119 N° 2 5389913..5390087 175 N° 3 5389735..5389800 66 N° 4 5388975..5389023 49
N° 5 5388809..5388894 86 N° 6 5388602..5388681 80 N° 7 5388402..5388504 103 N° 8 5388253..5388315 63
complement(join(5388253..5388315,5388402..5388504,5388602..5388681,5388809..5388 894,5388975..5389023,5389735..5389800,5389913..5390087,5390187..5390305))


exon

Literature and cross-references GmAPx26 (Glyma1_01-PACid_16286786 / Glyma1_01-PACid_16286787)
DNA ref. Phytozome 11:   Gm12 (5390305..5388253)
Protein sequence: GmAPx26 (Glyma1_01-PACid_16286786 / Glyma1_01-PACid_16286787)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   246
PWM (Da):   %s   26633.61  
PI (pH):   %s   6.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSADYQKAVEKAKKKLRGFIAEKRCAPLMLRLAWHSAGTYDVSSKTGGPFGTIKHPSELAHGANNGLDIAVRLLEPLKAEFPILSYADFYLAGVVAVEVTGGPEVPFHPGREDKPEPPPEGRLPDATKGSDHLRDVFGKAMGLSDRDIVALSGGHTGAAHKERSGFEGPWTSNPLIFDNSYFKELLSGEKEGLLQLPSDKALLSDPVFRPLVEKYADEDAFFADYAEAHQKLSELG*

Retrieve as FASTA  
Remarks Complete sequence from genomic. No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGTCTTACCCAACCGTGAGCGCTGATTACCAGAAGGCCGTTGAGAAGGCGAAGAAGAAGCTCAGAGGCTTCATCGCTGAGAAGAGATGCGCTCCTCTAATGCTCCGTTTGGCG
TACGTTTTTTTTTTCCATTTAACTTTAGATCACTGTTATTTACGACTCTGAGTTTGTTGACTGTCGTTTTGACACGTTTTGGTACGTTTTGTGTGCAGATGGCACTCTGCTGGAACTTAC
GACGTGAGCTCGAAGACCGGTGGTCCCTTCGGAACCATAAAGCACCCCTCCGAACTCGCTCACGGCGCTAACAACGGTCTTGACATCGCTGTTAGGCTTTTGGAGCCACTCAAAGCGGAG
TTTCCTATTTTGAGCTACGCCGATTTCTACCAG
GTGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTGAGAATTTGTTGTTACTTGTCTTTGGTGCTTGTGCGCTT
ATTTCTGTGTTTGTGTTTAACGCAGTTGGCTGGCGTTGTTGCCGTTGAGGTCACCGGTGGACCTGAAGTTCCCTTCCATCCTGGAAGAGAGGTATCGTACTGCAAGTTTTTAGTTCACAC
TGTTACTGTCCGTTGTTCGATTTGATTAAATTTTATATTGTATATAATAATACATGATAATCTATGTTTTGTAAACTGATTTGATTGTATTTTTAATTTTTATGCTGAATTTTGTTTTGC
TCGTAGTGAACGGTAGTTGTTGTAGAGCTATTGAATTGTGGATTCGGATTCCCTGCATTCAATTTTATTCATTCACGCATTAACAATTTAGAACTGTTTGATGAAGATAGACGGCTCATT
AAGTCATTTAACACGTTCATATTTTATTTCAACAAATCTGATTTATTATAAGCATTTATCTGATTTGTCAGATGTCCATCCATTGGTATGACTGTGTGAATGCGTTATTTTGACTGCACT
GAATCTGTTTCCTTGGATTCTCATGGTGTATAATCTGTGGCATTTCCCCCCATAAAATTCCTTTAATAGTTAACATTTTTTCCACAAGATTCCGTTAATAGCTAAAACTCGCAATTTGTT
CTACAAGATTTGCTTGGGATACTTACCAATTTTGATTGCATGTATTGTTGCTTTGGATACTTTGCAGCATATTTGTTGCTTGTATTATTATTTTGCACCCAATTTTAGAAAATTACGGGG
CACTATTTTGCTGTCGCAACTTTTTTGTGCGATATGATTGATTGTCATTTTTGAAACTAATGTGGTGGTTTGTTCTGATCAGGACAAACCTGAGCCACCACCAGAGGGTCGCTTGCCCGA
TGCCACTAAGG
GTCAGTACTCTAAACTTGTTTCAAGAATTTTGTGATTGGTAGGGATTGCTTTGCTTAGGGTTTGTTCCTGATTGTTGCAGGTTCTGACCATTTGAGAGATGTGTTTGGC
AAAGCTATGGGGCTTAGTGACCGAGATATCGTTGCTCTGTCTGGGGGTCACACTATT
GTATGTTATGATTTTAAATTTATTTGTTTTAGCTACATTGTCAAATTATACTGCTATTATATT
GGAAAAAATGTAATATCTAAACTCGTAGCTTTACTGGTGTAATTTTGCCAAATGTATTTTGTAGGGAGCTGCGCACAAGGAGCGTTCTGGATTCGAGGGTCCCTGGACCTCTAATCCTCT
TATTTTCGACAACTCATACTTCAA
GTGAGTATTTTTACGTCTCAGCAAAAAAATTAACACTTCTTTTTTACTTGTTGGAATTTTCATTCTAACTCTTTATCTATGTCCTAAAATGTTTTA
GGGAGTTGTTGAGTGGTGAGAAAGAAGGCCTCCTTCAGCTACCTTCTGACAAGGCACTTTTGTCTGACCCTGTGTTCCGCCCTCTTGTTGAGAAATATGCATCGGTATGTATTTCGTAAT
ATTTTGCATAACATTGAATTTTTGGAATGTAGAACATTTCTTGATGTATTTGATTTGGTAATGACTTCAGGACGAAGATGCCTTCTTCGCTGATTACGCTGAGGCTCACCAAAAGCTTTC
TGAGCTTGGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAAGTCTTACCCAACCGTGAGCGCTGATTACCAGAAGGCCGTTGAGAAGGCGAAGAAGAAGCTCAGAGGCTTCATCGCTGAGAAGAGATGCGCTCCTCTAATGCTCCGTTTGGCA
TGGCACTCTGCTGGAACTTACGACGTGAGCTCGAAGACCGGTGGTCCCTTCGGAACCATAAAGCACCCCTCCGAACTCGCTCACGGCGCTAACAACGGTCTTGACATCGCTGTTAGGCTT
TTGGAGCCACTCAAAGCGGAGTTTCCTATTTTGAGCTACGCCGATTTCTACCAG
TTGGCTGGCGTTGTTGCCGTTGAGGTCACCGGTGGACCTGAAGTTCCCTTCCATCCTGGAAGAGAG
GACAAACCTGAGCCACCACCAGAGGGTCGCTTGCCCGATGCCACTAAGGGTTCTGACCATTTGAGAGATGTGTTTGGCAAAGCTATGGGGCTTAGTGACCGAGATATCGTTGCTCTGTCT
GGGGGTCACACTATT
GGAGCTGCGCACAAGGAGCGTTCTGGATTCGAGGGTCCCTGGACCTCTAATCCTCTTATTTTCGACAACTCATACTTCAAGGAGTTGTTGAGTGGTGAGAAAGAA
GGCCTCCTTCAGCTACCTTCTGACAAGGCACTTTTGTCTGACCCTGTGTTCCGCCCTCTTGTTGAGAAATATGCATCG
GACGAAGATGCCTTCTTCGCTGATTACGCTGAGGCTCACCAA
AAGCTTTCTGAGCTTGGGTAA

Retrieve as FASTA