Entry information : ShirDyPrx01 (Stehi-DyP1)
Entry ID 9876
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: ShirDyPrx01 (Stehi-DyP1)
Name (synonym) ShirDyPrx01 (Stehi-DyP1)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Stereaceae Stereum
Organism Stereum hirsutum    [TaxId: 40492 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ShirDyPrx01
start..stop
S start..stop
ShirDyPrx02 616 0 1..478 1..493
HanDyPrx01 536 0 1..477 1..488
CsuDyPrx01 506 8e-178 1..472 1..481
TvDyPrx01 486 5e-170 1..471 1..483
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 404504..404559 56 N° 2 404199..404437 239 N° 3 403833..404118 286 N° 4 403604..403756 153
N° 5 403402..403541 140 N° 6 402997..403323 327 N° 7 402663..402901 239  
complement(join(402663..402901,402997..403323,403402..403541,403604..403756,4038 33..404118,404199..404437,404504..404559))


exon

Literature and cross-references ShirDyPrx01 (Stehi-DyP1)
DNA ref. JGI genome:   scaffold_5 (404559..402663)
Protein sequence: ShirDyPrx01 (Stehi-DyP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   479
PWM (Da):   %s   52383.5  
PI (pH):   %s   6.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSTTDQPLDFDNIQGEILPGFPKPSLTYVLFQITNAKAFRTALADLVPLITSTAQVMGHRQTIAHHKAKVAQNKSEPGMLDIVCVNVAFSQTGLTTHIKDPSFVNGQLSDANDLGDTGSFESGTFVPSDWLDAFRNPVHGAIIISGPTPIVIRNKVNDVENMFGVHSGHSSLKVVLELVGQPRPKPHNGHEHFGFLDGISHPAVEGFDITPNPGQQTVPQGTILLGRLGDEIIRPKWAVDGSFLALRHLSQLVPEFDEFLIDNPIKDSNMPPDQASELLGARMVGRWKGAPIDMTPFEDEPSLGKDPTRNNNFRFEGEVDSQDRCPFAAHIRKTNPRADLEDHGTLIGKNRIIRRGIQFGPEVTKKEREEGKTIEDRGLIFACYQSNIGNGFKFIQQSWANEPDFPHKGAGLDPIIGQTNSAGVRHMPGTDPLSQGKDLTIPMQFVVSKGGEYFFAPSISTLRDVFAVNMHIEAQK

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTACGACAGACCAACCGCTTGATTTTGACAACATACAGGGCGAAATCTTGTCTGTCCATCTACATTAATTCTTGTTCGTATTCATATCTGATGACTTTGTTTCCCGCTCCTGC
AGGCCTGGTTTCCCGAAACCGAGCTTGACATACGTCTTGTTCCAGATCACCAACGCGAAAGCCTTTCGTACCGCACTCGCCGACCTAGTCCCTCTCATCACTTCCACAGCTCAGGTCATG
GGGCACCGCCAGACCATCGCGCACCACAAAGCGAAAGTAGCGCAGAACAAATCCGAGCCTGGAATGTTGGACATCGTCTGTGTCAACGTCGCTTTCTCGCAGACCGGCTTGACTACTGTA
C
GTCACGTTATCAGACTTTCCTCCATGTTTGTACTGAGTCGGAACTCTGTTGCTATTATTTGTAGATGGAGATCACCGAAGACATAAAGGACCCCTCGTTCGTCAACGGCCAGCTCAGTG
ATGCTAATGATCTTGGCGACACAGGGTCATTTGAGTCTGGCACCTTCGTCCCCTCTGACTGGCTCGATGCGTTCAGGAACCCCGTTCACGGTGCTATCATCATATCCGGCCCTACCCCTA
TAGTAATCAGAAACAAGGTCAATGACGTCGAGAATATGTTCGGCGTTCATAGCGGTCATAGTAGCCTGAAGGTCGTGTTGGAACTCGTCGGTCAACCGAGACCGAAGCCCCACAATGGTC
ATGAGCA
GTCAGTGTTACTACAACATTTTCTCTTGTTCTCTAAGAACAACTGCTGACCTCTGGGACCCGTATTTATCCGTCAGCTTTGGTTTCCTCGACGGTATCTCCCATCCTGCCGTC
GAAGGCTTTGACATCACGCCCAACCCTGGTCAACAGACTGTTCCTCAGGGTACCATACTGCTTGGACGACTTGGTGACGAGATTATACGCCCGAAGTGGGCCGTTGATGGTAGCTT
GTAA
GCTTTTAAATGTATCTTGACATTATAGAGACCCGTGGATTAACGATCATCTTGTATAGCCTCGCTCTTCGTCACCTCTCCCAGCTGGTTCCTGAGTTCGACGAGTTTCTGATCGACAACC
CGATCAAGGACTCGAATATGCCTCCAGACCAGGCCAGTGAATTGCTGGGTGCTCGGATGGTCGGTCGTTGGAAGAGCG
GTGTGTTTCTCTCTTTGCTCACTGGAGACGTTCATCGCTGTG
TTCTCTGTATATATTTACAGTGATTCTTCCTTTTAGGTGCACCGATCGACATGACTCCTTTCGAAGATGAGCCCAGCCTTGGGAAAGACCCCACCAGGAACAATAACTTCCGCTTCGAAG
GCGAAGTCGATTCGCAGGATCGCTGCCCCTTCGCCGCTCACATCCGGAAGACGAACCCTCGCGCAGACCTCGAGGATCATGGCACTCTCATCGGAAAGAACCGTATTATCAGGCGTGGAA
TCCAGTTCGGACCCGAGGTGACGAAGAAGGAGAGAGAGGAGGGGAAGACGATTGAGGACAGGGGTCTCATCTTTGCTTGCTACCAGAGCAACATCGGGAATGGATTCAAGTTCATTCAAC
AAA
GTGTGTTAAAATGACCTCGTTCCATCCTCGAGTCCTGCGTATGCTAATCATATCCTTCTTACGAACTCGTGTGACGACGGCACGTTCTCCTCTAGGCTGGGCGAACGAACCTGACTT
TCCTCACAAGGGAGCAGGACTGGATCCCATCATCGGACAAACCAACAGCGCCGGCGTTCGACACATGCCGGGTACAGACCCCTTATCTCAAGGGAAAGACCTCACAATCCCCATGCAGTT
TGTAGTTTCGAAAGGGGGTGAATATTTCTTCGCTCCATCGATCTCTACTCTGCGCGATGTTTTCGCCGTGAATATGCATATTGAGGCGCAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCTACGACAGACCAACCGCTTGATTTTGACAACATACAGGGCGAAATCTTGCCTGGTTTCCCGAAACCGAGCTTGACATACGTCTTGTTCCAGATCACCAACGCGAAAGCCTTT
CGTACCGCACTCGCCGACCTAGTCCCTCTCATCACTTCCACAGCTCAGGTCATGGGGCACCGCCAGACCATCGCGCACCACAAAGCGAAAGTAGCGCAGAACAAATCCGAGCCTGGAATG
TTGGACATCGTCTGTGTCAACGTCGCTTTCTCGCAGACCGGCTTGACTACTGTAC
ACATAAAGGACCCCTCGTTCGTCAACGGCCAGCTCAGTGATGCTAATGATCTTGGCGACACAGGG
TCATTTGAGTCTGGCACCTTCGTCCCCTCTGACTGGCTCGATGCGTTCAGGAACCCCGTTCACGGTGCTATCATCATATCCGGCCCTACCCCTATAGTAATCAGAAACAAGGTCAATGAC
GTCGAGAATATGTTCGGCGTTCATAGCGGTCATAGTAGCCTGAAGGTCGTGTTGGAACTCGTCGGTCAACCGAGACCGAAGCCCCACAATGGTCATGAGCA
CTTTGGTTTCCTCGACGGT
ATCTCCCATCCTGCCGTCGAAGGCTTTGACATCACGCCCAACCCTGGTCAACAGACTGTTCCTCAGGGTACCATACTGCTTGGACGACTTGGTGACGAGATTATACGCCCGAAGTGGGCC
GTTGATGGTAGCTT
CCTCGCTCTTCGTCACCTCTCCCAGCTGGTTCCTGAGTTCGACGAGTTTCTGATCGACAACCCGATCAAGGACTCGAATATGCCTCCAGACCAGGCCAGTGAATTG
CTGGGTGCTCGGATGGTCGGTCGTTGGAAGAGCG
GTGCACCGATCGACATGACTCCTTTCGAAGATGAGCCCAGCCTTGGGAAAGACCCCACCAGGAACAATAACTTCCGCTTCGAAGGC
GAAGTCGATTCGCAGGATCGCTGCCCCTTCGCCGCTCACATCCGGAAGACGAACCCTCGCGCAGACCTCGAGGATCATGGCACTCTCATCGGAAAGAACCGTATTATCAGGCGTGGAATC
CAGTTCGGACCCGAGGTGACGAAGAAGGAGAGAGAGGAGGGGAAGACGATTGAGGACAGGGGTCTCATCTTTGCTTGCTACCAGAGCAACATCGGGAATGGATTCAAGTTCATTCAACAA
A
GCTGGGCGAACGAACCTGACTTTCCTCACAAGGGAGCAGGACTGGATCCCATCATCGGACAAACCAACAGCGCCGGCGTTCGACACATGCCGGGTACAGACCCCTTATCTCAAGGGAAA
GACCTCACAATCCCCATGCAGTTTGTAGTTTCGAAAGGGGGTGAATATTTCTTCGCTCCATCGATCTCTACTCTGCGCGATGTTTTCGCCGTGAATATGCATATTGAGGCGCAGAAGTAA

Retrieve as FASTA