Entry information : ShirDyPrx02 (DyP2)
Entry ID 9877
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: ShirDyPrx02 (DyP2)
Name (synonym) ShirDyPrx02 (DyP2)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Stereaceae Stereum
Organism Stereum hirsutum    [TaxId: 40492 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ShirDyPrx02
start..stop
S start..stop
HanDyPrx01 652 0 4..491 2..487
ShirDyPrx01 616 0 1..493 1..478
CsuDyPrx01 593 0 1..486 1..480
TvDyPrx01 548 0 3..488 2..485
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 500585..500646 62 N° 2 500716..500953 238 N° 3 501022..501326 305 N° 4 501400..501555 156
N° 5 501613..501752 140 N° 6 501814..502149 336 N° 7 502213..502457 245  
join(500585..500646,500716..500953,501022..501326,501400..501555,501613..501752, 501814..502149,502213..502457)


exon

Literature and cross-references ShirDyPrx02 (DyP2)
DNA ref. JGI genome:   scaffold_2 (500585..502457)
Protein sequence: ShirDyPrx02 (DyP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   493
PWM (Da):   %s   53595.29  
PI (pH):   %s   6.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSTTIPRASLDLTDIQGDILSGLPKKTQTYVFFQITDANDFRIALSDLVPVITSTEQVLKHRKSIADNKKKAAEHGHAPPLLDDIVGVNIAFSHTGLVMGITDDIGDKAFTDGQLSDAENLGDKGSTDAHGNFVPSDWLNAFRHPVHGVILLSGPSHASVKAMLRDVEQIFRVGSHHSSIKIVLEVVGDVRPGKEKGHEHFGFLDGISQPAVEGFDTKPNPGQETIPQGVMLLGRDVDKANKRPEWAVDGSFLALRYLSQLVPEFDKFLDENPIDLPGLPREKGSELLGARMVGRWKGAPIDITPLMDDPALGSDPLRNNNFRYQGELNSQTRCPFAAHTRKTNPRASLEDFGQGGNSIAKNRIIRRGVQFGPEVTEREREEGKTINDRGLIFACYQSNIENGFQFLQSSWANQPKFPPGTTVTPGLDPIIGQTTDAGARQMSGANPKSPENNITFPIEFVVSKGGEYFFSPSISAIRDSFALGVQIQGQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCGACCACGATCCCACGTGCATCGTTAGACCTCACGGACATCCAAGGCGATATCCTGTACGTCCATTCATCTTCCGTTCACCTAGATATCTCCCATCTGACGCTTCAGTCGTGT
ACCTACTCTAGGTCGGGCTTGCCCAAGAAGACGCAGACCTACGTCTTCTTCCAAATCACCGACGCCAACGACTTCCGGATCGCCCTCTCCGACCTCGTACCGGTCATCACGTCCACAGAG
CAGGTCTTGAAGCACCGGAAGTCTATCGCGGATAACAAGAAGAAAGCGGCCGAACATGGGCACGCGCCTCCGTTGCTCGACGACATCGTCGGCGTCAACATCGCGTTCTCGCATACCGGC
CTAGTCACC
GTACGTCTCACTTTGTTAATGAACAAGCCACTTCGTCTCTTTACTAAACTGGTGGGTTCCCGTTGTAGATGGGCATTACGGACGACATTGGTGACAAAGCGTTTACGGATG
GTCAGCTCAGCGATGCGGAGAACCTCGGGGACAAAGGCTCGACGGATGCCCATGGAAATTTCGTCCCCTCGGACTGGTTGAACGCTTTCAGACACCCCGTCCACGGAGTCATTTTACTTT
CTGGTCCGAGCCACGCCTCCGTGAAGGCCATGCTCCGAGACGTCGAGCAGATTTTCCGTGTTGGTAGCCATCATTCCAGTATCAAGATTGTGTTGGAGGTTGTTGGCGATGTGAGGCCTG
GGAAGGAGAAGGGTCATGAGCA
GTAAGCTTCTTCCTTCTGCGTCTTACGATCACGGATGTGCGTCACTGACTGACTGTCCATGTTGAACTCTCAGTTTCGGTTTCCTCGATGGGATTTCA
CAGCCTGCCGTCGAAGGCTTCGACACTAAACCGAATCCTGGTCAAGAGACGATCCCTCAGGGTGTCATGCTCCTGGGTCGGGACGTTGACAAGGCCAACAAGCGTCCGGAGTGGGCCGTC
GACGGTAGCTT
GTAAGTCATCTTTACAGACATCGCACGATTCAATATATGGGCTAATTCCTTTCATAGCCTCGCCCTTCGTTACCTTTCACAGTTGGTGCCCGAGTTCGACAAATTTTTG
GATGAGAACCCAATCGATCTCCCTGGTTTGCCTCGAGAGAAGGGGAGTGAGTTGCTGGGTGCTCGGATGGTCGGTCGCTGGAAGAGCG
GTAAGTCTGTGCTCTCGTATTGTAATCTGCAC
TTCTTTCTGACCGTACATGCACCTTCTAGGGGCTCCCATTGACATCACGCCGCTCATGGACGACCCCGCCCTTGGGTCAGACCCCTTGAGAAACAACAACTTCCGCTACCAGGGCGAGCT
CAACTCGCAAACACGCTGCCCGTTCGCCGCACACACCCGGAAGACCAATCCTCGTGCTAGTCTCGAAGACTTCGGTCAAGGTGGGAACTCTATCGCGAAGAACCGTATTATCAGACGTGG
CGTGCAGTTTGGGCCGGAGGTGACGGAACGGGAGAGGGAGGAAGGAAAGACGATTAACGATAGGGGTCTCATCTTTGCTTGCTACCAGAGCAACATTGAGAACGGGTTCCAATTTCTTCA
AAGCT
GTGAGTCTCATGCGTCTAGTACTCAATCTCATTCTGGTCTGATAATGTGCTCGATGTGTGTAGCTTGGGCGAATCAACCCAAGTTCCCTCCGGGCACGACAGTCACTCCAGGACT
CGATCCCATCATTGGGCAAACGACGGACGCTGGCGCTCGCCAGATGTCAGGGGCCAACCCAAAGTCGCCAGAGAACAACATCACGTTCCCTATCGAGTTCGTTGTGTCAAAGGGCGGCGA
GTATTTCTTCAGTCCTTCTATCTCCGCTATACGCGATTCGTTTGCTCTCGGCGTGCAGATCCAGGGACAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTTCGACCACGATCCCACGTGCATCGTTAGACCTCACGGACATCCAAGGCGATATCCTGTCGGGCTTGCCCAAGAAGACGCAGACCTACGTCTTCTTCCAAATCACCGACGCCAAC
GACTTCCGGATCGCCCTCTCCGACCTCGTACCGGTCATCACGTCCACAGAGCAGGTCTTGAAGCACCGGAAGTCTATCGCGGATAACAAGAAGAAAGCGGCCGAACATGGGCACGCGCCT
CCGTTGCTCGACGACATCGTCGGCGTCAACATCGCGTTCTCGCATACCGGCCTAGTCACC
ATGGGCATTACGGACGACATTGGTGACAAAGCGTTTACGGATGGTCAGCTCAGCGATGCG
GAGAACCTCGGGGACAAAGGCTCGACGGATGCCCATGGAAATTTCGTCCCCTCGGACTGGTTGAACGCTTTCAGACACCCCGTCCACGGAGTCATTTTACTTTCTGGTCCGAGCCACGCC
TCCGTGAAGGCCATGCTCCGAGACGTCGAGCAGATTTTCCGTGTTGGTAGCCATCATTCCAGTATCAAGATTGTGTTGGAGGTTGTTGGCGATGTGAGGCCTGGGAAGGAGAAGGGTCAT
GAGCA
TTTCGGTTTCCTCGATGGGATTTCACAGCCTGCCGTCGAAGGCTTCGACACTAAACCGAATCCTGGTCAAGAGACGATCCCTCAGGGTGTCATGCTCCTGGGTCGGGACGTTGAC
AAGGCCAACAAGCGTCCGGAGTGGGCCGTCGACGGTAGCTT
CCTCGCCCTTCGTTACCTTTCACAGTTGGTGCCCGAGTTCGACAAATTTTTGGATGAGAACCCAATCGATCTCCCTGGT
TTGCCTCGAGAGAAGGGGAGTGAGTTGCTGGGTGCTCGGATGGTCGGTCGCTGGAAGAGCG
GGGCTCCCATTGACATCACGCCGCTCATGGACGACCCCGCCCTTGGGTCAGACCCCTTG
AGAAACAACAACTTCCGCTACCAGGGCGAGCTCAACTCGCAAACACGCTGCCCGTTCGCCGCACACACCCGGAAGACCAATCCTCGTGCTAGTCTCGAAGACTTCGGTCAAGGTGGGAAC
TCTATCGCGAAGAACCGTATTATCAGACGTGGCGTGCAGTTTGGGCCGGAGGTGACGGAACGGGAGAGGGAGGAAGGAAAGACGATTAACGATAGGGGTCTCATCTTTGCTTGCTACCAG
AGCAACATTGAGAACGGGTTCCAATTTCTTCAAAGCT
CTTGGGCGAATCAACCCAAGTTCCCTCCGGGCACGACAGTCACTCCAGGACTCGATCCCATCATTGGGCAAACGACGGACGCT
GGCGCTCGCCAGATGTCAGGGGCCAACCCAAAGTCGCCAGAGAACAACATCACGTTCCCTATCGAGTTCGTTGTGTCAAAGGGCGGCGAGTATTTCTTCAGTCCTTCTATCTCCGCTATA
CGCGATTCGTTTGCTCTCGGCGTGCAGATCCAGGGACAGTGA

Retrieve as FASTA