Entry information : MpopDyPrx
Entry ID 9878
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2012-04-27 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-13 (Christophe Dunand)
Peroxidase information: MpopDyPrx
Name MpopDyPrx
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella populorum (Septoria musiva)    [TaxId: 85929 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MpopDyPrx
start..stop
S start..stop
SpopDyPrx 825 0 1..415 46..460
MpiDyPrx01 591 0 3..484 2..489
BcomDyPrx 456 3e-158 2..484 3..454
MgDyPrx 313 1e-104 7..282 1..275
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 496894..497175 282 N° 2 497226..498179 954 N° 3 498288..498503 216  
join(496894..497175,497226..498179,498288..498503)


exon

Literature and cross-references MpopDyPrx
DNA ref. JGI genome:   scaffold_7 (496894..498503)
Protein sequence: MpopDyPrx
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   484
PWM (Da):   %s   53103.79  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATNITDLSNVQGDILLKGLTKEVETFWFFTIVDSTEFGHALRRVANHDISHTQHVLDTRRHIKHFKAQRGHSHTEKLPTVGANISFSFSGLQKIAAVTGLQVSTGDTIFETGMKAAAVSDLHDPVKADDPQTPDWEADWLDNQIDGVLLVAGNCKDIVHKKLHHIISQFGSSVQRALKIDGNVRPGTQKGKEHFGYQDGISQPIVGDLPNLTKEEMFVPPGQDIIPQGVILCGRPGDAKASSRPSWMLDGSFLCFRKLQQDVSAWENFVVQSSSELGISPDLLGARLVGRWKSGCPINLQPDFDNTEIARDVLRNNFFEFDPTGLNSAQEFTITSGQPSVNCPLGAHIRKTNPRGDQPPDGRASVNIHRILRRGIPYGPEMDEDPAAERGLLFACYQSDLSQGFELIQKRWANDPSFRFPNSGLDALIGQTNSEPTVGMKGLVPDDANRELHVSGINRFVIPKGGEYFFSPSLSALRGELSDV

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCAATATCACTGATCTCAGCAATGTCCAAGGCGACATTCTCCTCAAAGGCTTGACGAAAGAGGTCGAGACTTTTTGGTTCTTCACCATTGTCGACAGTACCGAATTTGGTCAC
GCTCTACGCAGGGTAGCGAATCATGACATCTCGCATACACAACATGTCCTGGACACCCGTCGCCACATCAAGCACTTCAAAGCCCAGAGAGGCCATTCGCATACCGAGAAGCTGCCGACC
GTCGGTGCTAACATCTCATTCTCCTTCAGTGGACTCCAAAAG
GTTCGCCACATCACGTGTGGGTCCCGTGCATCTCTGACGATAGACAACAGATCGCCGCCGTCACCGGTCTGCAAGTGA
GCACAGGCGATACCATCTTCGAGACCGGAATGAAAGCTGCAGCTGTGTCTGATTTGCACGATCCTGTAAAAGCAGACGACCCTCAAACTCCAGACTGGGAAGCAGACTGGCTCGACAACC
AGATCGATGGCGTATTGCTCGTTGCCGGCAACTGCAAGGATATTGTCCATAAGAAACTGCACCACATAATCTCTCAATTCGGATCTTCCGTGCAGCGTGCACTCAAGATCGATGGTAATG
TCCGTCCAGGGACACAAAAGGGTAAAGAACACTTTGGTTATCAAGACGGAATCTCGCAGCCAATCGTGGGCGACCTCCCTAACCTCACCAAGGAGGAGATGTTTGTTCCTCCCGGACAAG
ACATCATCCCCCAAGGCGTCATCCTCTGCGGCCGACCCGGCGACGCCAAAGCCTCCAGCCGACCCTCCTGGATGCTCGACGGCTCCTTCCTCTGCTTCCGCAAACTCCAACAAGACGTGT
CCGCCTGGGAAAACTTTGTCGTCCAATCCTCCTCCGAACTCGGCATCTCCCCGGACCTCCTTGGAGCCCGCCTTGTCGGCCGCTGGAAATCCGGATGTCCCATTAACCTCCAACCCGACT
TCGACAACACCGAAATCGCGCGAGACGTCCTCCGAAACAACTTCTTCGAATTCGACCCCACGGGCCTAAACTCTGCCCAAGAGTTTACCATTACATCCGGTCAGCCGAGTGTCAATTGTC
CCCTTGGCGCTCATATCCGGAAGACGAACCCCAGAGGCGATCAACCCCCGGACGGGCGAGCGAGTGTCAATATCCATCGGATCTTACGCCGAGGAATTCCATATGGTCCAGAAATGGATG
AAGATCCTGCTGCGGAGCGAGGCTTGCTGTTTGCGTGTTATCAGAGTGATCTCAGTCAAGGGTTTGAGTTGATTCAGAAACGTTGG
GTGAGTGATCTCTCCCTCTCTCTCCCTCACTCTC
TCTGTGTACCCTTTCCCTTGTTTTCCAATATATCTTCTCAAAATCTCTCCCTCCCTTCTAACTATAAAACACAGGCTAACGACCCCTCCTTCCGCTTCCCCAACTCCGGCCTCGACGCCC
TCATCGGCCAAACCAATTCCGAACCCACCGTAGGCATGAAAGGTCTCGTGCCGGACGACGCCAATCGAGAATTACACGTGTCGGGTATCAATCGCTTCGTGATTCCCAAGGGAGGAGAGT
ATTTCTTTTCGCCGTCATTGAGTGCGTTGAGAGGGGAGTTGTCGGATGTG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACCAATATCACTGATCTCAGCAATGTCCAAGGCGACATTCTCCTCAAAGGCTTGACGAAAGAGGTCGAGACTTTTTGGTTCTTCACCATTGTCGACAGTACCGAATTTGGTCAC
GCTCTACGCAGGGTAGCGAATCATGACATCTCGCATACACAACATGTCCTGGACACCCGTCGCCACATCAAGCACTTCAAAGCCCAGAGAGGCCATTCGCATACCGAGAAGCTGCCGACC
GTCGGTGCTAACATCTCATTCTCCTTCAGTGGACTCCAAAAG
ATCGCCGCCGTCACCGGTCTGCAAGTGAGCACAGGCGATACCATCTTCGAGACCGGAATGAAAGCTGCAGCTGTGTCT
GATTTGCACGATCCTGTAAAAGCAGACGACCCTCAAACTCCAGACTGGGAAGCAGACTGGCTCGACAACCAGATCGATGGCGTATTGCTCGTTGCCGGCAACTGCAAGGATATTGTCCAT
AAGAAACTGCACCACATAATCTCTCAATTCGGATCTTCCGTGCAGCGTGCACTCAAGATCGATGGTAATGTCCGTCCAGGGACACAAAAGGGTAAAGAACACTTTGGTTATCAAGACGGA
ATCTCGCAGCCAATCGTGGGCGACCTCCCTAACCTCACCAAGGAGGAGATGTTTGTTCCTCCCGGACAAGACATCATCCCCCAAGGCGTCATCCTCTGCGGCCGACCCGGCGACGCCAAA
GCCTCCAGCCGACCCTCCTGGATGCTCGACGGCTCCTTCCTCTGCTTCCGCAAACTCCAACAAGACGTGTCCGCCTGGGAAAACTTTGTCGTCCAATCCTCCTCCGAACTCGGCATCTCC
CCGGACCTCCTTGGAGCCCGCCTTGTCGGCCGCTGGAAATCCGGATGTCCCATTAACCTCCAACCCGACTTCGACAACACCGAAATCGCGCGAGACGTCCTCCGAAACAACTTCTTCGAA
TTCGACCCCACGGGCCTAAACTCTGCCCAAGAGTTTACCATTACATCCGGTCAGCCGAGTGTCAATTGTCCCCTTGGCGCTCATATCCGGAAGACGAACCCCAGAGGCGATCAACCCCCG
GACGGGCGAGCGAGTGTCAATATCCATCGGATCTTACGCCGAGGAATTCCATATGGTCCAGAAATGGATGAAGATCCTGCTGCGGAGCGAGGCTTGCTGTTTGCGTGTTATCAGAGTGAT
CTCAGTCAAGGGTTTGAGTTGATTCAGAAACGTTGG
GCTAACGACCCCTCCTTCCGCTTCCCCAACTCCGGCCTCGACGCCCTCATCGGCCAAACCAATTCCGAACCCACCGTAGGCATG
AAAGGTCTCGTGCCGGACGACGCCAATCGAGAATTACACGTGTCGGGTATCAATCGCTTCGTGATTCCCAAGGGAGGAGAGTATTTCTTTTCGCCGTCATTGAGTGCGTTGAGAGGGGAG
TTGTCGGATGTG

Retrieve as FASTA