Entry information : PstrDyPrx02 (DyP2)
Entry ID 9879
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PstrDyPrx02 (DyP2)
Name (synonym) PstrDyPrx02 (DyP2)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrDyPrx02
start..stop
S start..stop
PstrDyPrx05 800 0 1..510 1..507
PbreDyPrx01 556 0 38..510 34..503
PbreDyPrx03 547 0 38..510 34..503
PbreDyPrx02 538 0 33..510 31..504
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 999769..999901 133 N° 2 999616..999715 100 N° 3 999115..999560 446 N° 4 998474..999055 582
N° 5 998144..998415 272  
complement(join(998144..998415,998474..999055,999115..999560,999616..999715,9997 69..999901))


exon

Literature and cross-references PstrDyPrx02 (DyP2)
DNA ref. JGI genome:   scaffold_6 (999901..998144)
Protein sequence: PstrDyPrx02 (DyP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   511 (488)
PWM (Da):   %s   54215.11 (51805.8) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.38 (4.35) Peptide Signal:   %s   cut: 23 range:23-510
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQYSRLLAFTLLAVANVSGVFGATAAQPALKPRQSSVRTTPLLKNFKGQPALPSLASVQATNATGSALDLANIQGDIFVGMKKPVENFYFFHINDAAQFKADFKTQLSIITSAATLISPPADQPAAYVNVGFSQSGLTALGVTDDLGDADFSSGQFAQAAALKDDTTQWEPEFKGTNIHGVFLVGSDVGTNIQDTFNDAIQELLKSATIVYELDGAARPGAEAGHEHFGYLDGISNPGVDGFTTDPKPGQSVVDAGIILTGEDGDSVTRPAWALDGSFLAFRKLKQLVPEYKKWLLDNAVQSPAGNLTQQEGADLLGARIFGRWPSGAPIDLTPLADDPALGADPSRNNDFDFSHPDSDITSDQSHCPFAAHIRKTRPRADLNNANVVNQAIRAGIPYGPEVTADESASNTTSIDRGLAFVMYQSNIGNGFQFQQTVWVDNQNFIFGKNISSVGLDMVIGQPGAGLERSASGFDPTDFDKVFTQNPTIISNGGEYFFVPSISALNNTILA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATACTCTCGTCTTCTCGCTTTCACTTTGCTCGCTGTCGCGAACGTCAGCGGTGTCTTTGGCGCCACCGCTGCCCAGCCTGCTCTCAAGCCCCGCCAGAGCAGCGTACGAACGACG
CCTCTGCTGAAGA
GTACGCCGTCCGTTTTTGCTGTCGGTTCAACACTGACGACAACATTCCATCAGACTTCAAGGGCCAGCCTGCGTTGCCCTCTCTCGCTTCTGTGCAGGCGACCAATG
CCACAGGCAGCGCTCTGGACCTCGCGAACATCCAGGGTGATATTTT
GTGCGTGTCGGCGAGGCAGCGACCGATGGTCGTGTCATTGATCGACTTCTTCCAGTGTTGGGATGAAGAAGCCC
GTGGAAAACTTTTACTTCTTCCACATCAACGATGCGGCCCAGTTCAAGGCCGACTTCAAGACCCAGCTCTCGATCATCACCTCGGCGGCGACCTTGATCTCGCCCCCCGCAGACCAGCCT
GCGGCTTACGTTAACGTGGGCTTCTCGCAGAGTGGCTTGACCGCTCTCGGTGTCACCGACGATCTCGGTGATGCCGACTTCAGCTCTGGTCAGTTTGCTCAGGCGGCGGCATTGAAGGAT
GATACTACGCAATGGGAACCCGAGTTCAAGGGCACGAACATCCATGGCGTCTTCCTCGTCGGCAGTGACGTCGGCACCAACATCCAGGACACGTTCAACGACGCCATCCAGGAACTCTTG
AAGTCTGCCACGATTGTCTACGAACTTGACGGTGCCGCTCGCCCTGGCGCTGAGGCCGGCCACGAAC
GTGAGCTTCTTTTTCTGGCTGAATCATCGGAAGTCGTGCGCTAACGGTCGCTC
TTCCAGACTTCGGCTACTTGGACGGGATCTCCAACCCTGGCGTCGACGGCTTCACGACGGATCCGAAACCGGGTCAGTCCGTCGTCGACGCCGGCATCATCCTCACCGGCGAGGATGGCG
ACAGCGTGACGCGCCCGGCATGGGCGCTCGACGGCTCTTTCCTCGCCTTCCGCAAGCTCAAGCAGCTCGTTCCCGAGTACAAGAAGTGGCTGCTCGACAACGCCGTCCAGAGCCCGGCCG
GAAACCTCACGCAGCAGGAAGGCGCCGACCTGCTCGGCGCGCGTATCTTCGGTCGCTGGCCCAGCGGCGCACCCATCGACCTCACCCCGCTCGCGGACGACCCCGCGCTCGGCGCCGACC
CGTCCCGAAACAACGACTTCGACTTCAGCCACCCCGACTCGGACATCACCAGCGACCAGTCGCACTGCCCCTTCGCCGCGCACATCCGCAAGACGCGCCCGCGCGCCGACCTGAACAACG
CGAACGTCGTCAACCAAGCGATCCGCGCCGGCATCCCGTACGGTCCCGAAGTCACTGCAGATGAGTCGGCCTCCAACACCACCAGCATCGACCGCGGCCTCGCCTTCG
GTGAGCGCGCTG
CTTAATTCCCATTCGGCGCATGTCACTAACCCGAGGCCTTTCTCAGTGATGTACCAGTCTAACATCGGGAACGGCTTCCAGTTCCAGCAGACCGTCTGGGTCGACAACCAGAACTTCATC
TTCGGCAAGAACATCTCGTCCGTCGGTCTCGACATGGTCATCGGCCAACCGGGTGCCGGCCTCGAGCGCAGCGCGTCCGGCTTTGACCCGACCGACTTCGACAAGGTCTTCACCCAGAAC
CCGACCATCATCTCTAACGGCGGCGAGTACTTCTTCGTTCCCTCGATCTCGGCCCTGAACAACACCATCCTGGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAATACTCTCGTCTTCTCGCTTTCACTTTGCTCGCTGTCGCGAACGTCAGCGGTGTCTTTGGCGCCACCGCTGCCCAGCCTGCTCTCAAGCCCCGCCAGAGCAGCGTACGAACGACG
CCTCTGCTGAAGA
ACTTCAAGGGCCAGCCTGCGTTGCCCTCTCTCGCTTCTGTGCAGGCGACCAATGCCACAGGCAGCGCTCTGGACCTCGCGAACATCCAGGGTGATATTTTTGTTGGG
ATGAAGAAGCCCGTGGAAAACTTTTACTTCTTCCACATCAACGATGCGGCCCAGTTCAAGGCCGACTTCAAGACCCAGCTCTCGATCATCACCTCGGCGGCGACCTTGATCTCGCCCCCC
GCAGACCAGCCTGCGGCTTACGTTAACGTGGGCTTCTCGCAGAGTGGCTTGACCGCTCTCGGTGTCACCGACGATCTCGGTGATGCCGACTTCAGCTCTGGTCAGTTTGCTCAGGCGGCG
GCATTGAAGGATGATACTACGCAATGGGAACCCGAGTTCAAGGGCACGAACATCCATGGCGTCTTCCTCGTCGGCAGTGACGTCGGCACCAACATCCAGGACACGTTCAACGACGCCATC
CAGGAACTCTTGAAGTCTGCCACGATTGTCTACGAACTTGACGGTGCCGCTCGCCCTGGCGCTGAGGCCGGCCACGAAC
ACTTCGGCTACTTGGACGGGATCTCCAACCCTGGCGTCGAC
GGCTTCACGACGGATCCGAAACCGGGTCAGTCCGTCGTCGACGCCGGCATCATCCTCACCGGCGAGGATGGCGACAGCGTGACGCGCCCGGCATGGGCGCTCGACGGCTCTTTCCTCGCC
TTCCGCAAGCTCAAGCAGCTCGTTCCCGAGTACAAGAAGTGGCTGCTCGACAACGCCGTCCAGAGCCCGGCCGGAAACCTCACGCAGCAGGAAGGCGCCGACCTGCTCGGCGCGCGTATC
TTCGGTCGCTGGCCCAGCGGCGCACCCATCGACCTCACCCCGCTCGCGGACGACCCCGCGCTCGGCGCCGACCCGTCCCGAAACAACGACTTCGACTTCAGCCACCCCGACTCGGACATC
ACCAGCGACCAGTCGCACTGCCCCTTCGCCGCGCACATCCGCAAGACGCGCCCGCGCGCCGACCTGAACAACGCGAACGTCGTCAACCAAGCGATCCGCGCCGGCATCCCGTACGGTCCC
GAAGTCACTGCAGATGAGTCGGCCTCCAACACCACCAGCATCGACCGCGGCCTCGCCTTCG
TGATGTACCAGTCTAACATCGGGAACGGCTTCCAGTTCCAGCAGACCGTCTGGGTCGAC
AACCAGAACTTCATCTTCGGCAAGAACATCTCGTCCGTCGGTCTCGACATGGTCATCGGCCAACCGGGTGCCGGCCTCGAGCGCAGCGCGTCCGGCTTTGACCCGACCGACTTCGACAAG
GTCTTCACCCAGAACCCGACCATCATCTCTAACGGCGGCGAGTACTTCTTCGTTCCCTCGATCTCGGCCCTGAACAACACCATCCTGGCCTGA

Retrieve as FASTA