Entry information : PstrDyPrx03 (DyP3)
Entry ID 9882
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: PstrDyPrx03 (DyP3)
Name (synonym) PstrDyPrx03 (DyP3)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD004]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Punctularia
Organism Punctularia strigosozonata    [TaxId: 202698 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PstrDyPrx03
start..stop
S start..stop
PstrDyPrx01 608 0 27..505 35..503
PbreDyPrx01 474 1e-164 25..501 24..497
BaDyPrx02 461 1e-159 1..505 1..493
BaDyPrx06 453 2e-156 1..506 1..497
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 758848..758962 115 N° 2 759017..759119 103 N° 3 759184..759525 342 N° 4 759578..759716 139
N° 5 759773..759921 149 N° 6 759973..760163 191 N° 7 760224..760335 112 N° 8 760390..760436 47
N° 9 760493..760549 57 N° 10 760612..760883 272  
join(758848..758962,759017..759119,759184..759525,759578..759716,759773..759921, 759973..760163,760224..760335,760390..760436,760493..760549,760612..760883)


exon

Literature and cross-references PstrDyPrx03 (DyP3)
DNA ref. JGI genome:   scaffold_9 (758848..760883)
Protein sequence: PstrDyPrx03 (DyP3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   509 (488)
PWM (Da):   %s   54677.04 (52575.8)  
PI (pH):   %s   4.52 (4.43) Peptide Signal:   %s   cut: 21 range:21-508
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLLGLVASLLPTLPTAVLAAATSPGRRDVVRDVPLLLNIPGQVVLPTIEEILTANLTNGSYVTTDNIQSDILVGMKKNIELFWFFHVNDATGFKSALRNTIHPLVTSTTTILGPVSQQPLAMVNIAFSHSGLTSLGILDDLGDIVFPFGMTADASVLGDPGTVNWHPPFVGTGIHGVIIIASDQQQFINDTLDEITEGLGTSATEVTRVNGAARQGENLGHEHFGFLDGIGPGISGFNPTFAPGVELSLPGTILLGRLGDIGVRPAWAKDGSFLVFRLLQQFVPEFDKYLVDNAIQAPDGSLTPEEGAELLGARMIGRWKSGAPVDLFPRKDNATAGTDPNVNNFDYDHPLPFLLPANQSYCPWTAHTRKNRPRADELDVNGIMVIMRSSIPYGPVTAAELAANKTSIDRGLAFVAYNSDIGLGFRFQQTMWDNSQIFPPLKTDITPGFEPIISLNNGNTRSTAGLDPFDPGREYVLEDFTLARGGEYFFSPPIPALLDPIGKA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCCTACTCGGTCTTGTTGCGTCGCTTCTTCCGACTCTTCCAACAGCTGTCCTTGCTGCTGCCACGAGCCCGGGTCGTCGAGACGTCGTGCGTGATGTGCCGCTACTTTTGAGTGGG
TGATTTACATCGTATGTCTGAAGTATCGCTCAATGACCATAAAACGTAGATATTCCCGGCCAGGTTGTTCTGCCAACCATCGAGGAGATTCTCACCGCAAATCTCACCAATGGATCCTAC
GTAACAACAGACAACATTCAATCCGATATACT
GTGAGTGCCATCCTTCGACTGAGCTTGTGTACAGCTTGTACTAATCCCGCAACCCTCTCTCCAGAGTCGGCATGAAGAAGAACATCGA
ATTGTTTTGGTTCTTCCACGTGAACGACGCGACCGGCTTCAAGTCTGCTCTGAGGAATACGATCCATCCGCTGGTCACTTCAACGACGACCATATTGGGGCCTGTGTCGCAGCAACCATT
GGCGATGGTCAACATCGCCTTCTCCCACAGCGGTCTTACTTCCCTCGGCATATTGGATGATCTCGGAGATATTGTATTCCCTTTCGGCATGACTGCGGATGCATCTGTGCTCGGTGATCC
CGGTACCGTGAACTGGCACCCACCCTTCGTTGGCACGGGAATCCATGGCGTCATCATCATCGCATCCGACCAGCAGCA
GTGAGTGCTCATCCTCGGATGATGATTGTAGCATTAAGCGTT
GCTTCTGCAGGTTCATCAACGACACGCTGGATGAAATCACCGAGGGCCTTGGGACTTCGGCCACGGAGGTTACTCGCGTTAACGGCGCGGCAAGACAGGGAGAGAACCTCGGTCACGAAC
ACTTTGGTTTCCTAGACGGCATTGGCCAG
GTAGAGTCAGAGTTCGCTGTTAAAGTGCCGAGGCATTGACCTTGATCGTTATGCAGCCTGGAATATCTGGCTTCAACCCGACTTTTGCCCC
AGGGGTAGAACTCAGTCTTCCCGGTACCATCCTCTTGGGAAGGCTTGGCGACATTGGGGTGCGACCTGCCTGGGCTAAGGACGGCTCGTTCCTCGTATTCCGCCTCTTGCAGCA
GTGAGT
ATACTGTGATCTCACGAACACCAACCTCGCTGACGCACTGCCAAGATTTGTGCCGGAGTTCGACAAGTATCTCGTCGACAACGCCATTCAAGCCCCGGACGGCAGCTTGACGCCCGAGGA
AGGAGCTGAGTTATTGGGTGCCCGAATGATCGGCCGATGGAAATCCGGCGCACCTGTTGATCTCTTCCCGCGGAAGGATAATGCCACAGCCGGCACCGATCCCAACGTCAACAATA
GTGC
GTACGCCTTGTTTGCTAGAGCTAGGTGAAACAGAACACTCACTTCCTCCTACTCAGATTTCGATTATGATCACCCACTGCCGTTCCTCCTTCCAGCGAACCAGTCTTACTGCCCGTGGAC
GGCCCACACTCGCAAGAACCGACCGCGTGCGGATGAACTCGACGTCAA
GTGAGTTAATACAGCACTAAGCACCCGCAGAGCGTTGACAATAGTCTGTCAAAGTGGTATCATGGTGATCAT
GAGGTCATCAATCCCCTACGGTCCAGACG
GTAAGGAAACGCGCGGAAACGCTATACCATTCCTGATAGTGGTCCCTCTTTCTCAGTGACAGCCGCGGAGTTGGCCGCCAACAAGACTAGC
ATTGACCGTGGTCTGGCATTTG
GTGATTGATCACTTTCTCTGCAGATTCTTTTGCAGCGACTTATATATTCGTCTTTCATCCAGTTGCTTACAATAGCGACATCGGCCTTGGCTTCCGTT
TCCAGCAAACCATGTGGGACAACTCGCAAATATTCCCGCCTCTGAAGACGGACATCACCCCTGGTTTCGAGCCAATCATTTCGCTGAACAACGGCAACACGCGGTCCACCGCTGGACTTG
ACCCCTTCGACCCCGGGAGGGAATATGTACTCGAGGACTTCACTCTGGCGAGAGGTGGCGAGTACTTCTTCAGCCCACCCATTCCTGCGTTGTTGGATCCCATTGGGAAGGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCCTACTCGGTCTTGTTGCGTCGCTTCTTCCGACTCTTCCAACAGCTGTCCTTGCTGCTGCCACGAGCCCGGGTCGTCGAGACGTCGTGCGTGATGTGCCGCTACTTTTGAATATT
CCCGGCCAGGTTGTTCTGCCAACCATCGAGGAGATTCTCACCGCAAATCTCACCAATGGATCCTACGTAACAACAGACAACATTCAATCCGATATACT
AGTCGGCATGAAGAAGAACATC
GAATTGTTTTGGTTCTTCCACGTGAACGACGCGACCGGCTTCAAGTCTGCTCTGAGGAATACGATCCATCCGCTGGTCACTTCAACGACGACCATATTGGGGCCTGTGTCGCAGCAACCA
TTGGCGATGGTCAACATCGCCTTCTCCCACAGCGGTCTTACTTCCCTCGGCATATTGGATGATCTCGGAGATATTGTATTCCCTTTCGGCATGACTGCGGATGCATCTGTGCTCGGTGAT
CCCGGTACCGTGAACTGGCACCCACCCTTCGTTGGCACGGGAATCCATGGCGTCATCATCATCGCATCCGACCAGCAGCA
GTTCATCAACGACACGCTGGATGAAATCACCGAGGGCCTT
GGGACTTCGGCCACGGAGGTTACTCGCGTTAACGGCGCGGCAAGACAGGGAGAGAACCTCGGTCACGAACACTTTGGTTTCCTAGACGGCATTGGCCAG
CCTGGAATATCTGGCTTCAAC
CCGACTTTTGCCCCAGGGGTAGAACTCAGTCTTCCCGGTACCATCCTCTTGGGAAGGCTTGGCGACATTGGGGTGCGACCTGCCTGGGCTAAGGACGGCTCGTTCCTCGTATTCCGCCTC
TTGCAGCA
ATTTGTGCCGGAGTTCGACAAGTATCTCGTCGACAACGCCATTCAAGCCCCGGACGGCAGCTTGACGCCCGAGGAAGGAGCTGAGTTATTGGGTGCCCGAATGATCGGCCGA
TGGAAATCCGGCGCACCTGTTGATCTCTTCCCGCGGAAGGATAATGCCACAGCCGGCACCGATCCCAACGTCAACAATA
ATTTCGATTATGATCACCCACTGCCGTTCCTCCTTCCAGCG
AACCAGTCTTACTGCCCGTGGACGGCCCACACTCGCAAGAACCGACCGCGTGCGGATGAACTCGACGTCAA
TGGTATCATGGTGATCATGAGGTCATCAATCCCCTACGGTCCAGACGTG
ACAGCCGCGGAGTTGGCCGCCAACAAGACTAGCATTGACCGTGGTCTGGCATTTG
TTGCTTACAATAGCGACATCGGCCTTGGCTTCCGTTTCCAGCAAACCATGTGGGACAACTCGCAA
ATATTCCCGCCTCTGAAGACGGACATCACCCCTGGTTTCGAGCCAATCATTTCGCTGAACAACGGCAACACGCGGTCCACCGCTGGACTTGACCCCTTCGACCCCGGGAGGGAATATGTA
CTCGAGGACTTCACTCTGGCGAGAGGTGGCGAGTACTTCTTCAGCCCACCCATTCCTGCGTTGTTGGATCCCATTGGGAAGGCATGA

Retrieve as FASTA