Entry information : PbreDyPrx01 (DyP1)
Entry ID 9885
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreDyPrx01 (DyP1)
Name (synonym) PbreDyPrx01 (DyP1)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreDyPrx01
start..stop
S start..stop
PbreDyPrx03 763 0 22..503 22..503
PbreDyPrx02 762 0 17..503 17..504
BaDyPrx02 607 0 34..498 28..490
PgigDyPrx02 604 0 22..501 24..504
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 345929..346049 121 N° 2 345774..345876 103 N° 3 345393..345723 331 N° 4 345225..345339 115
N° 5 344584..345165 582 N° 6 344466..344532 67 N° 7 344214..344406 193  
complement(join(344214..344406,344466..344532,344584..345165,345225..345339,3453 93..345723,345774..345876,345929..346049))


exon

Literature and cross-references PbreDyPrx01 (DyP1)
DNA ref. JGI genome:   scaffold_9 (346049..344214)
Protein sequence: PbreDyPrx01 (DyP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   503 (481)
PWM (Da):   %s   53980.03 (51602.7)  
PI (pH):   %s   4.42 (4.37) Peptide Signal:   %s   cut: 23 range:23-503
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFLTVHPFLSLLLVSFGLGSFAIPSHENVMRQGRTAPLLTVFPGQAALPTLTDIINLNATNGTYLPIQNIQGDTLVGMKKAQEIFYFFHINDAPAFKSTMQSYISNITSVATLLSDPSAQPLAFVNVALSYSGLTTLGVPDDIGDSQFSAGQFADAVNLGDDISQWETAFKGTNIHGVFLIGSDSAYTTQYANDITSIFGSSITQVYQIDAAARPGSEAGHEHFGYLDGISNPAVTGFATTALPGQTIVAPGTILCNRLGDLALRPLWALDGTFMAFRKLQQKVPEFDHWTLDNAVQDPSLNLTQQEGAQLLGARMFGRWPSGAPIDITPHADDPELGADPERNNNFDFSHLGSSLASDQSRCPFSAHIRKTNPRADLLDLDTINHAIRAGIPYGPEVTSAESNSSTTTEDRGLAFVEYQSDIANGFRFQQITWANTANFPPLKTVIPGIEPIIGQGGGKIASGLNPNDQIETYAVPDFVVPKGGEYFFVPSISTLSEVFVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns). Uncorrect prediction from JGI (PS is too short)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTCACAGTCCATCCGTTCCTCTCGCTGTTGCTCGTGAGTTTTGGACTAGGCAGTTTTGCCATTCCAAGCCATGAGAATGTTATGCGACAGGGTAGAACTGCGCCTCTGTTGACA
G
GTACTTGAGTTCTGCGCACGCGATAGCCTTGATAGCTGACACATCTTGCCAGTTTTCCCGGGACAGGCTGCGCTGCCGACCCTTACAGACATAATCAACCTGAATGCCACGAACGGGAC
CTACCTCCCCATCCAGAACATACAAGGAGATACTCT
GTACGTCGCTAACTCTCACACCGCACAACATATTCTCATGTGGGGTATAGAGTTGGTATGAAGAAAGCGCAGGAAATCTTCTAC
TTTTTCCATATCAACGATGCTCCCGCTTTCAAGTCTACGATGCAGTCTTATATCTCCAACATCACCTCCGTTGCCACTTTGCTTTCTGACCCGTCAGCCCAGCCCCTCGCGTTTGTCAAT
GTCGCATTGTCGTATAGCGGTCTTACAACTTTAGGTGTTCCCGACGACATTGGGGACTCGCAATTCTCTGCGGGTCAATTCGCAGACGCCGTGAATCTCGGGGACGATATTTCTCAGTGG
GAGACAGCGTTCAAAGGCACAAATATCCATGGCGTGTTTCTGATCGGTAGCGATCAG
GTTAGTGCCATGAGATCCACACGGACGTGCCACTGATCATATCCATGTCGCAGAGCGCGTACA
CGACGCAATATGCCAACGACATCACCTCAATCTTCGGCAGCTCTATCACACAGGTGTACCAGATCGACGCGGCTGCGCGTCCAGGATCGGAAGCTGGTCACGAAC
GTGAGTATTTGTCTT
CACGGTACTAGTCAACTCTGATGAATATACCTTTGGATGCACAGATTTTGGGTACCTAGATGGCATCTCCAATCCAGCTGTCACGGGATTTGCTACGACAGCTCTTCCAGGACAGACCAT
TGTAGCTCCAGGTACCATTCTTTGCAACCGTCTCGGAGATCTAGCGCTACGCCCTTTGTGGGCCCTAGACGGCACGTTCATGGCATTCCGCAAGCTGCAGCAAAAGGTTCCAGAGTTCGA
TCACTGGACTTTGGACAATGCTGTGCAAGATCCCAGCCTGAATCTAACACAGCAAGAGGGCGCACAGCTTCTGGGAGCACGTATGTTTGGCCGCTGGCCGAGTGGAGCACCGATAGATAT
CACACCCCATGCCGATGACCCGGAACTAGGTGCAGACCCCGAGCGCAACAACAACTTCGATTTTTCGCACTTGGGCTCGAGCCTCGCTAGCGATCAGAGCCGCTGCCCTTTCAGCGCACA
TATACGTAAAACCAATCCTCGCGCAGATCTCTTAGACTTGGACACTATTAACCATGCCATTCGTGCCGGTATTCCCTACGGTCCCGAAGTGACGTCCGCGGAAAGTAATTCCTCTACTAC
CACTGAGGATCGTGGCCTCGCATTCG
GTAAGTTTGCATTGCTCATAGACCGGTTTTCAGGTCCTAAGATATTTACAGTTGAATACCAATCCGACATTGCCAATGGATTCCGCTTCCAGCA
AATTACGTGGGCGAACACTGCAAA
GTACGTGCTTTTTTTTTTTTAGAGTATTCTGTATTTACTTATGAACGGTCTCAACCCAGCTTTCCGCCTCTCAAGACGGTAATTCCTGGAATTGAG
CCAATCATCGGACAAGGCGGAGGTAAGATAGCGTCAGGATTGAATCCAAATGACCAGATCGAAACATATGCTGTGCCCGACTTTGTCGTTCCCAAAGGCGGCGAATACTTCTTCGTGCCG
TCGATCTCCACTTTATCCGAAGTCTTCGTTGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCCTCACAGTCCATCCGTTCCTCTCGCTGTTGCTCGTGAGTTTTGGACTAGGCAGTTTTGCCATTCCAAGCCATGAGAATGTTATGCGACAGGGTAGAACTGCGCCTCTGTTGACA
G
TTTTCCCGGGACAGGCTGCGCTGCCGACCCTTACAGACATAATCAACCTGAATGCCACGAACGGGACCTACCTCCCCATCCAGAACATACAAGGAGATACTCTAGTTGGTATGAAGAAA
GCGCAGGAAATCTTCTACTTTTTCCATATCAACGATGCTCCCGCTTTCAAGTCTACGATGCAGTCTTATATCTCCAACATCACCTCCGTTGCCACTTTGCTTTCTGACCCGTCAGCCCAG
CCCCTCGCGTTTGTCAATGTCGCATTGTCGTATAGCGGTCTTACAACTTTAGGTGTTCCCGACGACATTGGGGACTCGCAATTCTCTGCGGGTCAATTCGCAGACGCCGTGAATCTCGGG
GACGATATTTCTCAGTGGGAGACAGCGTTCAAAGGCACAAATATCCATGGCGTGTTTCTGATCGGTAGCGATCAG
AGCGCGTACACGACGCAATATGCCAACGACATCACCTCAATCTTC
GGCAGCTCTATCACACAGGTGTACCAGATCGACGCGGCTGCGCGTCCAGGATCGGAAGCTGGTCACGAAC
ATTTTGGGTACCTAGATGGCATCTCCAATCCAGCTGTCACGGGATTTGCT
ACGACAGCTCTTCCAGGACAGACCATTGTAGCTCCAGGTACCATTCTTTGCAACCGTCTCGGAGATCTAGCGCTACGCCCTTTGTGGGCCCTAGACGGCACGTTCATGGCATTCCGCAAG
CTGCAGCAAAAGGTTCCAGAGTTCGATCACTGGACTTTGGACAATGCTGTGCAAGATCCCAGCCTGAATCTAACACAGCAAGAGGGCGCACAGCTTCTGGGAGCACGTATGTTTGGCCGC
TGGCCGAGTGGAGCACCGATAGATATCACACCCCATGCCGATGACCCGGAACTAGGTGCAGACCCCGAGCGCAACAACAACTTCGATTTTTCGCACTTGGGCTCGAGCCTCGCTAGCGAT
CAGAGCCGCTGCCCTTTCAGCGCACATATACGTAAAACCAATCCTCGCGCAGATCTCTTAGACTTGGACACTATTAACCATGCCATTCGTGCCGGTATTCCCTACGGTCCCGAAGTGACG
TCCGCGGAAAGTAATTCCTCTACTACCACTGAGGATCGTGGCCTCGCATTCG
TTGAATACCAATCCGACATTGCCAATGGATTCCGCTTCCAGCAAATTACGTGGGCGAACACTGCAAAC
TTTCCGCCTCTCAAGACGGTAATTCCTGGAATTGAGCCAATCATCGGACAAGGCGGAGGTAAGATAGCGTCAGGATTGAATCCAAATGACCAGATCGAAACATATGCTGTGCCCGACTTT
GTCGTTCCCAAAGGCGGCGAATACTTCTTCGTGCCGTCGATCTCCACTTTATCCGAAGTCTTCGTTGCTTAA

Retrieve as FASTA