Entry information : PbreDyPrx02 (DyP2)
Entry ID 9886
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreDyPrx02 (DyP2)
Name (synonym) PbreDyPrx02 (DyP2)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreDyPrx02
start..stop
S start..stop
PbreDyPrx03 773 0 1..504 1..503
PbreDyPrx01 770 0 8..504 8..503
BaDyPrx02 590 0 38..499 32..490
PgigDyPrx02 584 0 20..502 22..504
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 872886..873006 121 N° 2 872727..872829 103 N° 3 872340..872670 331 N° 4 872170..872284 115
N° 5 871533..872114 582 N° 6 871410..871476 67 N° 7 871161..871356 196  
complement(join(871161..871356,871410..871476,871533..872114,872170..872284,8723 40..872670,872727..872829,872886..873006))


exon

Literature and cross-references PbreDyPrx02 (DyP2)
DNA ref. JGI genome:   scaffold_14 (873006..871161)
Protein sequence: PbreDyPrx02 (DyP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   504 (482)
PWM (Da):   %s   54018.68 (51692.5)  
PI (pH):   %s   4.15 (4.09) Peptide Signal:   %s   cut: 23 range:23-504
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFASFSLLALSLLSLGWHGHAVPNHDNMKRQSGPAPLLTIFPGQDVLPTLADIINLNATNGTYLPIQNIQGDILVGMKKTSEIFYFFHINDADDFKLAMQSYIPNITSTAVLLDDPSNQPLAFVNVAFSQTGLDTLGVTDDLGDAQFTGGQFADAPNLGDDVSLWEAPFAGTNIHGVFLIGSSSVFTTQYSADITTIFGSSISQVYEIDAAARPGAEAGHEHFGFLDGLSQPAVTGFATSVLPGQTIIAPGTILCNRPGDTAVRPIWALDGTFMAFRKLKQLVPEFNQWTLENSVEDTNNNLTQQEGAALMAARMFGRWPSGAPIDLTPFADDPELGADPQRNNDFDFSHLGEDLATDQTRCPFSAHIRKTNPRADLADADVVNHAIRGGTPYGPEVTAAENSTSTTTEDRGIAFVEYQGVIWNGFRFQQTMWANNPGFPNGKIPTSPGIDPIIGQGDGRVAAGLNPNSPLETFAVPQFVIPTGGEYFFVPSISTLSEVFIA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTTGCAAGCTTCTCACTGCTCGCTCTGTCTCTCCTGAGTCTTGGATGGCACGGCCACGCCGTTCCTAACCATGACAACATGAAAAGACAGTCTGGGCCTGCGCCGCTGCTGACA
A
GTAAGTGGGCTATACAATTTTTTGTGGAGGCCTCATACTAAACTTGCGTCTACCAGTCTTCCCCGGACAAGACGTGCTTCCGACTCTCGCAGATATTATCAACCTGAATGCCACGAACG
GTACATACCTCCCTATTCAGAATATACAAGGCGATATCCT
GTATGCCGGGAATTGTTTACGACGCACACGTTCAATACTGATATTCATTGTCACAGCGTGGGTATGAAGAAGACATCCGA
AATTTTCTATTTCTTTCACATCAACGACGCCGACGACTTCAAGTTAGCCATGCAGTCCTACATACCCAACATAACTTCTACCGCTGTCCTGCTTGACGACCCATCGAACCAGCCTCTTGC
CTTCGTCAACGTCGCGTTTTCGCAGACCGGCCTTGACACCCTGGGAGTTACTGACGACCTCGGCGATGCACAATTTACCGGGGGGCAGTTTGCTGATGCTCCAAATCTTGGAGACGACGT
TTCTCTCTGGGAAGCCCCTTTTGCAGGTACCAATATTCACGGCGTGTTCCTCATTGGCAGTAGCGAG
GTTGGTGCCGTCACATTATATCATGGACACGATAGTAATTTGGACGACATGAC
AGAGCGTGTTCACAACACAATATTCCGCCGACATTACGACAATCTTCGGCAGTTCCATCTCCCAGGTGTACGAGATTGATGCGGCGGCACGTCCAGGTGCGGAAGCCGGTCACGAGCGTA
AGTGGTCGTCTCTTTTGGAAAGCATGAGAGATGTATGTAATAACATTCACAGACTTTGGATTCCTCGACGGTCTCTCCCAGCCGGCCGTCACGGGCTTTGCCACATCAGTGCTTCCCGGA
CAGACTATCATAGCCCCTGGTACCATCTTGTGCAACCGCCCCGGAGACACCGCAGTACGCCCGATATGGGCCCTAGATGGCACGTTCATGGCCTTCCGCAAGCTGAAACAGCTGGTTCCG
GAATTCAACCAGTGGACGCTGGAGAACTCCGTCGAAGACACCAACAACAACCTCACGCAACAGGAAGGCGCGGCCCTTATGGCGGCACGCATGTTCGGTCGTTGGCCAAGCGGCGCACCA
ATCGATCTCACGCCCTTCGCCGACGATCCCGAGCTCGGAGCTGATCCTCAGCGGAACAACGACTTCGACTTCTCGCACCTGGGCGAGGACCTCGCAACCGATCAGACACGCTGCCCCTTC
AGTGCACACATACGCAAGACCAACCCCCGCGCAGACCTTGCCGACGCCGATGTCGTTAACCATGCTATCCGTGGCGGGACACCGTACGGGCCGGAAGTGACCGCGGCGGAGAATAGCACG
TCCACTACTACAGAGGATCGCGGCATCGCCTTCG
GTGAGTCCAGAATTGCATATATACCAGCCAGCGTGAATGCTGAGCTCGCTTTGCAGTGGAATACCAGGGCGTAATTTGGAACGGGT
TCCGCTTCCAGCAAACGATGTGGGCAAATAACCCTGG
GTGCGTCCCCTAGTTTCCTCTCTTTTACATACTCTTATGCGTACAATCTTTAGCTTCCCTAATGGCAAGATACCGACGTCGCC
TGGCATTGACCCGATTATTGGACAAGGAGATGGCAGGGTTGCTGCAGGCTTGAATCCCAACAGCCCGCTCGAGACGTTTGCCGTGCCCCAGTTCGTTATCCCGACGGGCGGCGAATATTT
CTTCGTGCCCTCGATCTCTACTCTTTCTGAGGTCTTTATTGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTTGCAAGCTTCTCACTGCTCGCTCTGTCTCTCCTGAGTCTTGGATGGCACGGCCACGCCGTTCCTAACCATGACAACATGAAAAGACAGTCTGGGCCTGCGCCGCTGCTGACA
A
TCTTCCCCGGACAAGACGTGCTTCCGACTCTCGCAGATATTATCAACCTGAATGCCACGAACGGTACATACCTCCCTATTCAGAATATACAAGGCGATATCCTCGTGGGTATGAAGAAG
ACATCCGAAATTTTCTATTTCTTTCACATCAACGACGCCGACGACTTCAAGTTAGCCATGCAGTCCTACATACCCAACATAACTTCTACCGCTGTCCTGCTTGACGACCCATCGAACCAG
CCTCTTGCCTTCGTCAACGTCGCGTTTTCGCAGACCGGCCTTGACACCCTGGGAGTTACTGACGACCTCGGCGATGCACAATTTACCGGGGGGCAGTTTGCTGATGCTCCAAATCTTGGA
GACGACGTTTCTCTCTGGGAAGCCCCTTTTGCAGGTACCAATATTCACGGCGTGTTCCTCATTGGCAGTAGCGAG
AGCGTGTTCACAACACAATATTCCGCCGACATTACGACAATCTTC
GGCAGTTCCATCTCCCAGGTGTACGAGATTGATGCGGCGGCACGTCCAGGTGCGGAAGCCGGTCACGAGC
ACTTTGGATTCCTCGACGGTCTCTCCCAGCCGGCCGTCACGGGCTTTGCC
ACATCAGTGCTTCCCGGACAGACTATCATAGCCCCTGGTACCATCTTGTGCAACCGCCCCGGAGACACCGCAGTACGCCCGATATGGGCCCTAGATGGCACGTTCATGGCCTTCCGCAAG
CTGAAACAGCTGGTTCCGGAATTCAACCAGTGGACGCTGGAGAACTCCGTCGAAGACACCAACAACAACCTCACGCAACAGGAAGGCGCGGCCCTTATGGCGGCACGCATGTTCGGTCGT
TGGCCAAGCGGCGCACCAATCGATCTCACGCCCTTCGCCGACGATCCCGAGCTCGGAGCTGATCCTCAGCGGAACAACGACTTCGACTTCTCGCACCTGGGCGAGGACCTCGCAACCGAT
CAGACACGCTGCCCCTTCAGTGCACACATACGCAAGACCAACCCCCGCGCAGACCTTGCCGACGCCGATGTCGTTAACCATGCTATCCGTGGCGGGACACCGTACGGGCCGGAAGTGACC
GCGGCGGAGAATAGCACGTCCACTACTACAGAGGATCGCGGCATCGCCTTCG
TGGAATACCAGGGCGTAATTTGGAACGGGTTCCGCTTCCAGCAAACGATGTGGGCAAATAACCCTGGC
TTCCCTAATGGCAAGATACCGACGTCGCCTGGCATTGACCCGATTATTGGACAAGGAGATGGCAGGGTTGCTGCAGGCTTGAATCCCAACAGCCCGCTCGAGACGTTTGCCGTGCCCCAG
TTCGTTATCCCGACGGGCGGCGAATATTTCTTCGTGCCCTCGATCTCTACTCTTTCTGAGGTCTTTATTGCCTGA

Retrieve as FASTA