Entry information : PbreDyPrx03
Entry ID 9887
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreDyPrx03
Name PbreDyPrx03
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreDyPrx03
start..stop
S start..stop
PbreDyPrx01 771 0 1..503 1..503
PbreDyPrx02 767 0 17..503 17..504
BaDyPrx03 585 0 21..503 14..498
TcuDyPrx01 583 0 21..503 14..498
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 458448..458568 121 N° 2 458625..458727 103 N° 3 458788..459118 331 N° 4 459171..459285 115
N° 5 459338..459919 582 N° 6 459982..460048 67 N° 7 460103..460295 193  
join(458448..458568,458625..458727,458788..459118,459171..459285,459338..459919, 459982..460048,460103..460295)


exon

Literature and cross-references PbreDyPrx03
DNA ref. JGI genome:   scaffold_17 (458448..460295)
Protein sequence: PbreDyPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   503 (478)
PWM (Da):   %s   53669.83 (51130.4)  
PI (pH):   %s   4.58 (4.52) Peptide Signal:   %s   cut: 26 range:26-503
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYFASFSLATLGLLTLGLRGVAVSAHDNVKRHSRSTPLLTVFPGQGALPALEDIVNLNATSGTFLPVDNIQGDILSGMKKVSEIFYFFHINDALAFKSAMQSYIPNITSLATLVGDPSSQPLAFVNIAFSQTGLIKLGIHEDLGDAQFSEGQFADAAYLGDDISQWEAPFKGTKIHGVFLIGSNSAYTAEYADDIPSIFGSSISQVYRIDAAARPGSEFGHEHFGFVDGLAQPAVAGFATTVYPGQTVVPPGIILCNRPGDNVSRPRWALDGTFMAFRKLQQKVPEFNQWTLDNAVQDPALNLTQQEGAALMAARMFGRWPSGAPTDLTPFADDPELGADPARNNNFDFSHPGSDLASDQSRCPFSAHIRKSNPRADLDDANVINHAIRAGTPYGPEVTPAEANSSVSTEDRGIAFVIYQGVIANGFRFQQVSWANNPDAPQGKVVTPGIDPIIGQGDGRIASGLNPNAQTETFAVPQVIVSNGGEYFFVPSISTLAEVFVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTTTGCGAGCTTTTCACTTGCTACCCTTGGTCTGTTGACTCTTGGATTGCGCGGCGTTGCCGTCTCTGCTCATGACAATGTCAAGAGACATTCGAGGTCTACACCGCTGTTGACA
G
GTAAGTAAGCCATGCACTTTTTTGTGGCAGTTCTCACTAAGACTTTTTCTTATCAGTATTCCCTGGGCAAGGCGCTCTTCCTGCTCTAGAGGACATAGTTAACTTGAATGCCACGAGTG
GTACGTTCCTCCCTGTTGACAACATACAAGGTGACATCCT
GTACGTCAAAGACCGTCTATTAGTACAATACGATCCCAGCTACTCATATTTTCGGCACAGTTCTGGTATGAAGAAGGTCT
CGGAGATCTTCTATTTCTTCCATATCAACGACGCGCTCGCTTTCAAGTCAGCAATGCAATCGTATATACCCAACATCACCTCGCTTGCTACCTTAGTCGGTGATCCATCTTCCCAGCCTC
TTGCTTTCGTCAACATCGCGTTCTCGCAAACCGGTCTTATCAAATTAGGAATCCATGAAGATCTTGGTGATGCGCAATTTTCCGAGGGACAATTTGCTGATGCTGCTTACCTCGGAGACG
ACATCTCACAGTGGGAGGCGCCGTTCAAAGGTACCAAGATTCATGGCGTGTTTTTGATTGGCAGCAATCAG
GTTGGTGCCGTTACGTCGTCCGAGTAGTACCAACTTTTACAAGATTATA
TAGAGTGCGTACACGGCAGAATACGCTGATGACATTCCGTCGATATTCGGCAGTTCCATCTCGCAGGTATACCGAATTGATGCGGCGGCACGTCCAGGCTCAGAATTTGGTCACGAGCGT
GAGTGATATATCTTCTCAGCCGTGACGAACGTATGTAACAGTAGACACAGACTTCGGGTTCGTGGATGGTCTCGCCCAGCCTGCTGTTGCTGGTTTTGCCACGACAGTATACCCCGGACA
GACTGTCGTACCCCCCGGTATAATCCTGTGCAACCGCCCAGGTGATAATGTGTCACGCCCACGATGGGCTCTGGACGGCACGTTCATGGCGTTCCGCAAACTACAGCAAAAGGTTCCGGA
ATTCAACCAGTGGACGCTGGACAACGCCGTACAAGATCCCGCCCTCAATCTTACACAGCAGGAAGGCGCAGCACTCATGGCGGCGCGCATGTTCGGCCGCTGGCCAAGTGGCGCACCAAC
CGATCTCACCCCCTTTGCGGACGACCCCGAGCTCGGGGCGGATCCTGCGCGCAACAACAACTTTGACTTTTCTCACCCCGGCTCGGACCTTGCAAGCGATCAGAGCCGCTGCCCCTTCAG
CGCACACATTCGGAAGTCCAATCCCCGTGCTGATCTAGATGATGCAAATGTTATCAATCACGCTATCCGTGCGGGCACGCCATATGGACCAGAAGTGACCCCGGCGGAGGCCAATTCGTC
TGTTTCCACAGAAGACCGCGGAATAGCATTTG
GTGAGTCCGACATTGACATCTACTCGTTGTACATAGACGTAAACATCAAATTTTGCTTCTAGTGATATATCAAGGTGTCATTGCCAAC
GGATTCCGCTTCCAGCAGGTGTCATGGGCTAACAATCCTGA
GTGCGCTCTTTCCCTTATTCATCCTTTACATATTCTTAAGTCTCCATTCTTTAGCGCCCCGCAGGGGAAGGTCGTAACA
CCCGGTATTGACCCAATAATTGGGCAAGGAGATGGCAGGATTGCTTCAGGCTTGAACCCCAATGCTCAAACCGAGACGTTTGCCGTTCCTCAGGTTATCGTTTCAAATGGTGGGGAATAC
TTCTTCGTGCCCTCCATCTCTACTCTTGCAGAGGTGTTTGTTGCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTTTGCGAGCTTTTCACTTGCTACCCTTGGTCTGTTGACTCTTGGATTGCGCGGCGTTGCCGTCTCTGCTCATGACAATGTCAAGAGACATTCGAGGTCTACACCGCTGTTGACA
G
TATTCCCTGGGCAAGGCGCTCTTCCTGCTCTAGAGGACATAGTTAACTTGAATGCCACGAGTGGTACGTTCCTCCCTGTTGACAACATACAAGGTGACATCCTTTCTGGTATGAAGAAG
GTCTCGGAGATCTTCTATTTCTTCCATATCAACGACGCGCTCGCTTTCAAGTCAGCAATGCAATCGTATATACCCAACATCACCTCGCTTGCTACCTTAGTCGGTGATCCATCTTCCCAG
CCTCTTGCTTTCGTCAACATCGCGTTCTCGCAAACCGGTCTTATCAAATTAGGAATCCATGAAGATCTTGGTGATGCGCAATTTTCCGAGGGACAATTTGCTGATGCTGCTTACCTCGGA
GACGACATCTCACAGTGGGAGGCGCCGTTCAAAGGTACCAAGATTCATGGCGTGTTTTTGATTGGCAGCAATCAG
AGTGCGTACACGGCAGAATACGCTGATGACATTCCGTCGATATTC
GGCAGTTCCATCTCGCAGGTATACCGAATTGATGCGGCGGCACGTCCAGGCTCAGAATTTGGTCACGAGC
ACTTCGGGTTCGTGGATGGTCTCGCCCAGCCTGCTGTTGCTGGTTTTGCC
ACGACAGTATACCCCGGACAGACTGTCGTACCCCCCGGTATAATCCTGTGCAACCGCCCAGGTGATAATGTGTCACGCCCACGATGGGCTCTGGACGGCACGTTCATGGCGTTCCGCAAA
CTACAGCAAAAGGTTCCGGAATTCAACCAGTGGACGCTGGACAACGCCGTACAAGATCCCGCCCTCAATCTTACACAGCAGGAAGGCGCAGCACTCATGGCGGCGCGCATGTTCGGCCGC
TGGCCAAGTGGCGCACCAACCGATCTCACCCCCTTTGCGGACGACCCCGAGCTCGGGGCGGATCCTGCGCGCAACAACAACTTTGACTTTTCTCACCCCGGCTCGGACCTTGCAAGCGAT
CAGAGCCGCTGCCCCTTCAGCGCACACATTCGGAAGTCCAATCCCCGTGCTGATCTAGATGATGCAAATGTTATCAATCACGCTATCCGTGCGGGCACGCCATATGGACCAGAAGTGACC
CCGGCGGAGGCCAATTCGTCTGTTTCCACAGAAGACCGCGGAATAGCATTTG
TGATATATCAAGGTGTCATTGCCAACGGATTCCGCTTCCAGCAGGTGTCATGGGCTAACAATCCTGAC
GCCCCGCAGGGGAAGGTCGTAACACCCGGTATTGACCCAATAATTGGGCAAGGAGATGGCAGGATTGCTTCAGGCTTGAACCCCAATGCTCAAACCGAGACGTTTGCCGTTCCTCAGGTT
ATCGTTTCAAATGGTGGGGAATACTTCTTCGTGCCCTCCATCTCTACTCTTGCAGAGGTGTTTGTTGCCTGA

Retrieve as FASTA