Entry information : CcinDyPrx03
Entry ID 9888
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2012-03-02 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-22 (Christophe Dunand)
Peroxidase information: CcinDyPrx03
Name CcinDyPrx03
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CcinDyPrx03
start..stop
S start..stop
GmarDyPrx05 607 0 1..544 1..525
CcinDyPrx[P]04 488 3e-171 110..398 1..290
PplDyPrx01 380 3e-124 6..544 9..542
GluxDyPrx02 369 5e-122 13..542 18..564
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..138 138 N° 2 194..530 337 N° 3 596..743 148 N° 4 801..1095 295
N° 5 1154..1366 213 N° 6 1423..1615 193 N° 7 1684..1994 311  
join(1..138,194..530,596..743,801..1095,1154..1366,1423..1615,1684..1994)


exon

Literature and cross-references CcinDyPrx03
DNA ref. JGI genome:   Chr_6 (146560..148553)
Protein sequence: CcinDyPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   545
PWM (Da):   %s   61501.64  
PI (pH):   %s   6.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQVPSTKLPYLQRRAIVPVDVRPGRTPGQLPDMANVQGDIYYMFPKRWERFLCFTINNADDFRKALDEYFPRVTNSKKTMKDVQNIHDRPGGNLNITSHAIGFTRNGLNTLGIMEKLRDPHFDQGPLINEKAKLGDMAEYDEAFVSGNNHGVFIICSGSQESCLSESNAIKDIFGSSITELGNYEGRVRSGDGEFFGWRDGISQPALEGLVQARPGQRVVKPGVIIMGYPGDPVLDVPTALQRPSWTKDGAFLVFRKLEQNVLFFEDYIEKNWRSIPANERGNGVYLTDEERKTLFGARMVGRFKSGVPLALSPYKEDRQYLHPDKINNFDYSESYGRCPFSAHIRKTAPRNLGPHLTKEFMDASVIVRAGIPYGPEISIEERQEWAKMTSEEKKSAKCDRGLLFACYQSSIENGFYRQTTQFANNSFFPPIGFLPKKTGMYPILGGPKYDKTPLKTIDDEGNVIDDDNARTFYSEEFSPPEYESPNAEFDVTMKVKNKEGDRFEVAGIAKKLHPTANDYEQEFFVTSRGGDYYFMPGLSTLKS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGTCCCATCAACTAAACTCCCCTATCTCCAGCGACGTGCCATAGTTCCGGTCGACGTCCGTCCTGGTAGAACTCCGGGCCAATTACCTGACATGGCGAATGTTCAGGGCGACATT
TACTACATGTTCCCAAAG
GTTCTGAACACCGTTGATTCTATGCTAAGGTCAAATCTAACAGTCGTTTATTTAGCGCTGGGAGCGATTCCTATGCTTCACAATCAACAATGCTGACGACTT
TCGCAAAGCCCTGGACGAATATTTCCCGAGAGTCACCAACTCGAAGAAGACTATGAAAGATGTCCAAAATATCCATGACAGACCCGGCGGTAATCTCAACATAACTTCCCATGCTATCGG
CTTCACAAGGAATGGATTGAATACACTTGGTATCATGGAGAAGCTTCGCGATCCCCATTTTGACCAAGGTCCACTTATCAACGAGAAGGCGAAATTGGGCGACATGGCCGAGTACGACGA
GGCCTTTGTTAGCGGCAACAACCATGGCGTATTCATCATCTGCTCTGGAT
GTGAGTGTGATCCTTTACATTCAGTCGATAATCGACGAATTCCTAACATGAACCTCGCTTTACAGCCCAG
GAGAGCTGCCTATCTGAATCGAACGCCATTAAGGACATATTTGGTAGCTCCATTACCGAGCTAGGAAACTACGAAGGTCGCGTTCGTAGTGGGGATGGTGAATTTTTTGGATGGCGGGAC
GGCATTTCGCAACCTGCACTAGA
GTAGGGGCCATTTCAACTCTTTGAACCGTTCGTGCTTCTAACCCTTTCTTGTCATAGGGGTCTTGTACAAGCACGACCTGGACAGCGCGTCGTAAAG
CCTGGCGTGATCATCATGGGGTACCCTGGAGACCCCGTTCTCGACGTTCCCACTGCGCTTCAGCGTCCGTCGTGGACCAAAGATGGCGCCTTTCTAGTCTTCAGAAAGCTGGAGCAAAAC
GTCCTTTTCTTCGAAGACTACATCGAGAAGAATTGGCGTTCTATCCCTGCTAACGAGCGCGGAAATGGTGTCTATCTCACAGACGAAGAGAGGAAGACACTCTTCGGCGCTCGGATGGTT
GGCCGATTCAAGTCG
GTAAGTTATGAGAGATTTGGACCGTCTGTTTCCAGTCACTCATTGGAATGATTCCAAGGGCGTTCCGCTTGCGTTATCGCCGTATAAAGAAGACCGCCAATATCT
CCACCCTGACAAGATCAACAACTTTGACTACTCCGAGAGTTATGGGCGTTGTCCCTTCTCCGCCCACATCCGCAAGACCGCGCCTAGAAACCTCGGTCCTCACCTTACGAAAGAATTTAT
GGATGCTTCGGTGATTGTTCGAGCTGGCATTCCGTACGGTCCAGAG
GTAAGGTTGCGATTCCGGCTGCAGATTTCCCACCTCGCTAACAGGCGACATCCCAGATCTCCATCGAGGAAAGA
CAAGAATGGGCAAAGATGACTTCGGAGGAGAAGAAATCTGCTAAGTGTGATCGTGGACTCCTCTTTGCTTGCTACCAGTCTTCTATTGAGAACGGGTTCTACCGCCAAACCACGCAATTC
GCCAACAACTCTTTCTTCCCTCCGATCGGTTTCTTGCCCAAGAAGACTGGTATGT
TTCTCTCCATCCTCACGATATCCATCCTCGACGTGAGACTGATCAGTGATCTCACACTGAAGGTC
AAGACCCAATTCTTGGGGGCCCTAAATATGACAAGACACCGTTGAAGACTATTGATGATGAAGGTAATGTGATCGACGACGACAACGCCAGAACCTTCTACTCCGAGGAATTCAGCCCAC
CTGAATATGAAAGTCCCAACGCCGAGTTTGATGTCACCATGAAGGTGAAGAACAAGGAGGGTGATCGCTTCGAGGTTGCGGGTATCGCAAAGAAACTGCATCCGACCGCCAACGATTACG
AGCAGGAGTTCTTTGTCACATCTCGAGGAGGGGATTATTATTTCATGCCGGGCCTTAGTACCTTGAAGAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGGTCCCATCAACTAAACTCCCCTATCTCCAGCGACGTGCCATAGTTCCGGTCGACGTCCGTCCTGGTAGAACTCCGGGCCAATTACCTGACATGGCGAATGTTCAGGGCGACATT
TACTACATGTTCCCAAAG
CGCTGGGAGCGATTCCTATGCTTCACAATCAACAATGCTGACGACTTTCGCAAAGCCCTGGACGAATATTTCCCGAGAGTCACCAACTCGAAGAAGACTATG
AAAGATGTCCAAAATATCCATGACAGACCCGGCGGTAATCTCAACATAACTTCCCATGCTATCGGCTTCACAAGGAATGGATTGAATACACTTGGTATCATGGAGAAGCTTCGCGATCCC
CATTTTGACCAAGGTCCACTTATCAACGAGAAGGCGAAATTGGGCGACATGGCCGAGTACGACGAGGCCTTTGTTAGCGGCAACAACCATGGCGTATTCATCATCTGCTCTGGAT
CCCAG
GAGAGCTGCCTATCTGAATCGAACGCCATTAAGGACATATTTGGTAGCTCCATTACCGAGCTAGGAAACTACGAAGGTCGCGTTCGTAGTGGGGATGGTGAATTTTTTGGATGGCGGGAC
GGCATTTCGCAACCTGCACTAGA
GGGTCTTGTACAAGCACGACCTGGACAGCGCGTCGTAAAGCCTGGCGTGATCATCATGGGGTACCCTGGAGACCCCGTTCTCGACGTTCCCACTGCG
CTTCAGCGTCCGTCGTGGACCAAAGATGGCGCCTTTCTAGTCTTCAGAAAGCTGGAGCAAAACGTCCTTTTCTTCGAAGACTACATCGAGAAGAATTGGCGTTCTATCCCTGCTAACGAG
CGCGGAAATGGTGTCTATCTCACAGACGAAGAGAGGAAGACACTCTTCGGCGCTCGGATGGTTGGCCGATTCAAGTCG
GGCGTTCCGCTTGCGTTATCGCCGTATAAAGAAGACCGCCAA
TATCTCCACCCTGACAAGATCAACAACTTTGACTACTCCGAGAGTTATGGGCGTTGTCCCTTCTCCGCCCACATCCGCAAGACCGCGCCTAGAAACCTCGGTCCTCACCTTACGAAAGAA
TTTATGGATGCTTCGGTGATTGTTCGAGCTGGCATTCCGTACGGTCCAGAG
ATCTCCATCGAGGAAAGACAAGAATGGGCAAAGATGACTTCGGAGGAGAAGAAATCTGCTAAGTGTGAT
CGTGGACTCCTCTTTGCTTGCTACCAGTCTTCTATTGAGAACGGGTTCTACCGCCAAACCACGCAATTCGCCAACAACTCTTTCTTCCCTCCGATCGGTTTCTTGCCCAAGAAGACTGGT
ATGT
ACCCAATTCTTGGGGGCCCTAAATATGACAAGACACCGTTGAAGACTATTGATGATGAAGGTAATGTGATCGACGACGACAACGCCAGAACCTTCTACTCCGAGGAATTCAGCCCA
CCTGAATATGAAAGTCCCAACGCCGAGTTTGATGTCACCATGAAGGTGAAGAACAAGGAGGGTGATCGCTTCGAGGTTGCGGGTATCGCAAAGAAACTGCATCCGACCGCCAACGATTAC
GAGCAGGAGTTCTTTGTCACATCTCGAGGAGGGGATTATTATTTCATGCCGGGCCTTAGTACCTTGAAGAGCTAG

Retrieve as FASTA