Entry information : MpiDyPrx01
Entry ID 9891
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: MpiDyPrx01
Name MpiDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella pini (Dothistroma septosporum )    [TaxId: 64363 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MpiDyPrx01
start..stop
S start..stop
MpopDyPrx 591 0 2..489 3..484
SpopDyPrx 499 5e-171 2..435 48..479
BcomDyPrx 449 3e-155 6..502 8..467
MgDyPrx 301 6e-100 6..287 1..276
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1851176..1851463 288 N° 2 1851521..1851825 305 N° 3 1851878..1852808 931  
join(1851176..1851463,1851521..1851825,1851878..1852808)


exon

Literature and cross-references MpiDyPrx01
DNA ref. JGI genome:   scaffold_8 (1851176..1852808)
Protein sequence: MpiDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   508
PWM (Da):   %s   55113.06  
PI (pH):   %s   8.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSITDLGNVQGDILLQGLNKEVETFAFFTIPTGQESAFARALRNVAQQEITSTQNVLTTQRTIKDFRTNLQPGAAVSQIPTVGANISFTFNGLQKISKVVNGLDIQSLNTGSFNSGMKTIAVGGLQDPIKPGTATDPVWADQWLNNKLDGVLLVAGQTTQLVQDKLNRITQLLGPAAKIAFKLDGNVRPGDQRGKEHFGYHDGISQPIVGGLPGLTKDESYVPPGQDTIDQGVILCGRPGDLRAQNRPQWMLDGSFLVFRQLKQNVQDWNNFLQQGANDLGVFKDQLGARLIGRWKSGCPVNLQADFDDVNIGKDKMRNNLFDFDPQGLDKNSLTITPGMRLVCPIGAHIRKTNPRGDQFGPNSDPRKNVSPHRILRRGIPYGPEISQNPTAERGLLFACYQSDLEEGFDFIQQNWANHPFFRFAGAGIDAVMGQSNSGASIGMKGLFPQDANRELQLPGINRFVVPRGGEYFFSPSISTMAGVMSNVAANGVANGVNGNRQMPLA

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTCCATCACAGATCTTGGCAACGTTCAAGGAGACATTCTCCTCCAGGGACTGAACAAGGAAGTGGAAACCTTCGCCTTCTTCACCATTCCCACTGGACAAGAGTCTGCCTTTGCT
CGGGCTCTTCGCAACGTAGCTCAACAAGAGATCACATCAACTCAGAACGTCTTGACTACACAACGAACTATCAAGGATTTCAGAACCAACCTTCAGCCAGGCGCAGCAGTCTCACAGATC
CCAACTGTTGGGGCGAACATCTCGTTCACGTTCAATGGACTGCAGAAG
GTAATTTTGCGGTCGCGCTTGTGCTCAGCTCTTTCAGATGCTGACCTCTTGTCTCAGATCTCCAAGGTCGTG
AACGGCCTTGACATCCAGAGCCTGAACACCGGAAGCTTTAATAGCGGCATGAAGACCATTGCTGTGGGTGGCTTACAAGACCCCATCAAGCCGGGAACGGCTACCGATCCAGTCTGGGCG
GACCAGTGGCTTAACAACAAGCTGGACGGAGTGCTTCTCGTTGCCGGTCAGACAACGCAGCTAGTGCAAGACAAGCTCAATCGCATCACTCAGCTTCTCGGACCAGCCGCCAAGATCGCC
TTCAAGCTTGATGGCAATGTTCGACCTGGTGACCAGAGAGGCAAAGAACA
GTAAGTCCCGATGTGGAAAATCTGGATGTATCTGTGTATTGATGGCTCTCAGCTTTGGCTATCACGACGG
AATATCACAACCAATCGTCGGCGGCCTGCCTGGACTTACAAAGGACGAGTCTTATGTTCCGCCAGGCCAGGATACCATCGACCAAGGAGTTATACTCTGCGGTCGTCCCGGCGATCTTCG
AGCTCAGAATCGCCCCCAGTGGATGCTTGACGGCAGCTTTCTCGTCTTCCGACAGCTTAAGCAGAATGTTCAAGACTGGAATAATTTCCTACAGCAAGGCGCCAACGACCTCGGCGTCTT
CAAGGATCAGCTTGGAGCTCGACTTATCGGCCGTTGGAAGTCAGGCTGCCCCGTTAACCTCCAAGCAGATTTCGACGATGTCAATATCGGCAAAGACAAGATGCGAAACAACCTATTTGA
TTTCGATCCCCAGGGCTTGGACAAGAACAGCCTGACCATCACGCCTGGCATGCGGCTCGTTTGCCCTATCGGCGCCCATATTCGCAAGACCAACCCTCGCGGCGATCAATTCGGTCCCAA
CTCTGACCCCCGCAAAAATGTCAGCCCTCATCGCATCTTACGTCGAGGCATCCCATACGGACCCGAGATCAGTCAAAACCCGACAGCTGAGCGTGGTCTCCTCTTCGCATGCTATCAAAG
CGATCTCGAAGAAGGCTTCGACTTCATCCAACAGAATTGGGCAAATCATCCTTTCTTCCGCTTCGCTGGCGCTGGTATCGATGCGGTCATGGGACAGTCCAACAGCGGAGCCAGCATTGG
TATGAAAGGTCTCTTCCCACAGGATGCCAATCGCGAATTACAGCTGCCCGGCATCAACCGCTTTGTTGTGCCGAGAGGAGGGGAGTACTTCTTCTCGCCGTCTATCTCGACCATGGCGGG
CGTGATGTCGAATGTGGCAGCGAATGGGGTCGCTAATGGAGTCAACGGCAACAGGCAGATGCCTCTTGCGAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTCCATCACAGATCTTGGCAACGTTCAAGGAGACATTCTCCTCCAGGGACTGAACAAGGAAGTGGAAACCTTCGCCTTCTTCACCATTCCCACTGGACAAGAGTCTGCCTTTGCT
CGGGCTCTTCGCAACGTAGCTCAACAAGAGATCACATCAACTCAGAACGTCTTGACTACACAACGAACTATCAAGGATTTCAGAACCAACCTTCAGCCAGGCGCAGCAGTCTCACAGATC
CCAACTGTTGGGGCGAACATCTCGTTCACGTTCAATGGACTGCAGAAG
ATCTCCAAGGTCGTGAACGGCCTTGACATCCAGAGCCTGAACACCGGAAGCTTTAATAGCGGCATGAAGACC
ATTGCTGTGGGTGGCTTACAAGACCCCATCAAGCCGGGAACGGCTACCGATCCAGTCTGGGCGGACCAGTGGCTTAACAACAAGCTGGACGGAGTGCTTCTCGTTGCCGGTCAGACAACG
CAGCTAGTGCAAGACAAGCTCAATCGCATCACTCAGCTTCTCGGACCAGCCGCCAAGATCGCCTTCAAGCTTGATGGCAATGTTCGACCTGGTGACCAGAGAGGCAAAGAACA
CTTTGGC
TATCACGACGGAATATCACAACCAATCGTCGGCGGCCTGCCTGGACTTACAAAGGACGAGTCTTATGTTCCGCCAGGCCAGGATACCATCGACCAAGGAGTTATACTCTGCGGTCGTCCC
GGCGATCTTCGAGCTCAGAATCGCCCCCAGTGGATGCTTGACGGCAGCTTTCTCGTCTTCCGACAGCTTAAGCAGAATGTTCAAGACTGGAATAATTTCCTACAGCAAGGCGCCAACGAC
CTCGGCGTCTTCAAGGATCAGCTTGGAGCTCGACTTATCGGCCGTTGGAAGTCAGGCTGCCCCGTTAACCTCCAAGCAGATTTCGACGATGTCAATATCGGCAAAGACAAGATGCGAAAC
AACCTATTTGATTTCGATCCCCAGGGCTTGGACAAGAACAGCCTGACCATCACGCCTGGCATGCGGCTCGTTTGCCCTATCGGCGCCCATATTCGCAAGACCAACCCTCGCGGCGATCAA
TTCGGTCCCAACTCTGACCCCCGCAAAAATGTCAGCCCTCATCGCATCTTACGTCGAGGCATCCCATACGGACCCGAGATCAGTCAAAACCCGACAGCTGAGCGTGGTCTCCTCTTCGCA
TGCTATCAAAGCGATCTCGAAGAAGGCTTCGACTTCATCCAACAGAATTGGGCAAATCATCCTTTCTTCCGCTTCGCTGGCGCTGGTATCGATGCGGTCATGGGACAGTCCAACAGCGGA
GCCAGCATTGGTATGAAAGGTCTCTTCCCACAGGATGCCAATCGCGAATTACAGCTGCCCGGCATCAACCGCTTTGTTGTGCCGAGAGGAGGGGAGTACTTCTTCTCGCCGTCTATCTCG
ACCATGGCGGGCGTGATGTCGAATGTGGCAGCGAATGGGGTCGCTAATGGAGTCAACGGCAACAGGCAGATGCCTCTTGCGAGC

Retrieve as FASTA