Entry information : CsuDyPrx01
Entry ID 9892
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2012-04-02 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-23 (Christophe Dunand)
Peroxidase information: CsuDyPrx01
Name CsuDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Ceriporiopsis
Organism Ceriporiopsis subvermispora    [TaxId: 42742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsuDyPrx01
start..stop
S start..stop
TvDyPrx01 650 0 1..481 1..484
TvDyPrx01_other 638 0 1..481 1..485
HanDyPrx01 631 0 1..480 1..482
DsDyPrx 606 0 3..481 2..483
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 146018..146073 56 N° 2 145724..145961 238 N° 3 145361..145659 299 N° 4 145024..145310 287
N° 5 144627..144965 339 N° 6 144352..144575 224  
complement(join(144352..144575,144627..144965,145024..145310,145361..145659,1457 24..145961,146018..146073))


exon

Literature and cross-references CsuDyPrx01
DNA ref. JGI genome:   scaffold_16 (146073..144352)
Protein sequence: CsuDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   481
PWM (Da):   %s   51426.56  
PI (pH):   %s   6.05
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSSTPAPLDLNNVQGDSLIGLPKKTQTYVFFQISDNVKAFRTQLAQLIPLITTAAQVSTHKQQIVQNKKTAAEKGVPPPLLKLSGVNIAFSHSGLVLGITDDIGDTAFDGGMLADAQNLGDQGTTSGSTFTPDWIPAFKNPVHGVILISGDSHITTGATLLEVEKIFAVGTHNATIVEVLRLVGDVRPGKEKGHEHFGFLDGISQPAVQGVDTNPNPGQETVSQGIILLGRDGDTVTRPAWALDGSLVALRYLKQLVPEFDTFLKQNPIPGPPPDLGSELLGARFVGRWKGAPIDLAPTADDPALGADSSRNNNFRYAFPDDPQTQDRCPFAAHTRKTNPRADLEDLSPPISTETRRIIRRGIQYGPEVTPLEAAKGQTENNRGLIFVAYQSNIVNGFQFIQHSWANNTGFPIDKPITPGFDPIIGQATDPSSRTLSGTNPNAQSNTLALPTQWVVPQGGEYFISPSIPALKSTFAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns). Incorrect prediction from JGI (in the 3'UTR of an oligopeptide transporter).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCCTCCACCCCAGCCCCTCTTGACTTGAACAACGTGCAAGGTGATAGTCTGTGAGTATAGTGTCTGGTTACGTCCCTTGTTGATGTATCTCACAATTTGACCATAGGATTGGCC
TGCCGAAGAAGACCCAGACATATGTCTTCTTCCAGATCAGCGACAACGTCAAGGCCTTCCGCACGCAGCTTGCACAGCTCATTCCCCTCATCACTACTGCCGCACAGGTCAGCACCCACA
AGCAGCAGATTGTCCAGAACAAGAAGACAGCCGCAGAGAAAGGCGTGCCGCCTCCTCTCCTGAAGCTTTCAGGCGTCAACATTGCCTTCTCCCACAGCGGATTGGTGAAG
GTTAGTCGTT
CATGTTTGAGCCATTGTATCTCTGTGACTTACTCTTGTTTGATATACCATGTAGTTAGGAATTACGGATGATATTGGCGACACCGCTTTCGACGGTGGTATGCTCGCGGACGCGCAGAAT
CTCGGCGATCAGGGTACCACGTCTGGCAGCACCTTCACTCCAGACTGGATCCCCGCATTCAAGAACCCCGTTCATGGCGTGATTCTTATCTCTGGGGATTCTCATATCACGACTGGTGCC
ACGTTACTCGAGGTGGAGAAGATATTCGCAGTTGGGACGCACAATGCTACCATTGTTGAGGTCCTGCGCCTTGTCGGAGACGTTCGACCGGGCAAGGAAAAAGGACATGAGCA
GTACGTT
CATTGGCGTAGTAACTCGTACCTAGTTCTGACATCGAGTATAGCTTCGGTTTCCTCGACGGCATCTCGCAGCCTGCTGTGCAAGGTGTTGACACCAATCCCAACCCTGGTCAGGAGACGG
TCAGCCAGGGTATCATCCTCCTTGGACGCGATGGCGATACTGTTACCCGTCCAGCGTGGGCGTTGGACGGCAGCTTGGTTGCACTTCGTTACCTGAAGCAGCTTGTGCCCGAGTTCGACA
CATTCCTCAAGCAGAACCCCATCCCTGGCCCGCCGCCGGACCTGGGTAGCGAGCTTCTTGGAGCACGCTTCGTTGGACGATGGAAGAGTG
GTATGTGTGATGATTTCGACTCCGCAATGT
GCAGGGCTAAATGTACGATGTCCATCAGGTGCGCCCATTGACCTTGCTCCGACCGCCGATGATCCCGCTCTTGGTGCTGATTCCTCCCGCAACAACAACTTCCGTTATGCCTTCCCCGAT
GACCCGCAGACCCAAGATCGATGCCCGTTTGCGGCGCACACCCGTAAGACCAACCCCAGGGCCGACCTCGAGGACCTTTCGCCTCCCATCTCCACTGAGACGCGCCGCATCATCCGTCGT
GGGATCCAATACGGACCTGAGGTTACTCCGCTGGAGGCCGCAAAGGGCCAGACGGAGAACAACCGTGGCCTCATCTTCGTCGCCTATCAGAGCAACATTGTGAACGGATTCCAGTTCATC
CAGCACA
GTACGTCTCTCGCTTGTTTGCGAGATGTTCTTGAGTTTTGACGCCATGTAGGCTGGGCGAACAATACTGGCTTCCCCATTGACAAGCCCATAACGCCTGGCTTCGACCCCATC
ATCGGCCAGGCAACGGACCCCTCGTCGCGCACGCTATCTGGTACGAACCCCAATGCACAGAGCAACACGCTCGCTCTGCCTACGCAGTGGGTCGTGCCTCAGGGTGGAGAATACTTCATC
TCGCCGTCCATCCCTGCTCTCAAGAGTACCTTTGCGGTCTCG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCCTCCACCCCAGCCCCTCTTGACTTGAACAACGTGCAAGGTGATAGTCTGATTGGCCTGCCGAAGAAGACCCAGACATATGTCTTCTTCCAGATCAGCGACAACGTCAAGGCC
TTCCGCACGCAGCTTGCACAGCTCATTCCCCTCATCACTACTGCCGCACAGGTCAGCACCCACAAGCAGCAGATTGTCCAGAACAAGAAGACAGCCGCAGAGAAAGGCGTGCCGCCTCCT
CTCCTGAAGCTTTCAGGCGTCAACATTGCCTTCTCCCACAGCGGATTGGTGAAG
TTAGGAATTACGGATGATATTGGCGACACCGCTTTCGACGGTGGTATGCTCGCGGACGCGCAGAAT
CTCGGCGATCAGGGTACCACGTCTGGCAGCACCTTCACTCCAGACTGGATCCCCGCATTCAAGAACCCCGTTCATGGCGTGATTCTTATCTCTGGGGATTCTCATATCACGACTGGTGCC
ACGTTACTCGAGGTGGAGAAGATATTCGCAGTTGGGACGCACAATGCTACCATTGTTGAGGTCCTGCGCCTTGTCGGAGACGTTCGACCGGGCAAGGAAAAAGGACATGAGCA
CTTCGGT
TTCCTCGACGGCATCTCGCAGCCTGCTGTGCAAGGTGTTGACACCAATCCCAACCCTGGTCAGGAGACGGTCAGCCAGGGTATCATCCTCCTTGGACGCGATGGCGATACTGTTACCCGT
CCAGCGTGGGCGTTGGACGGCAGCTTGGTTGCACTTCGTTACCTGAAGCAGCTTGTGCCCGAGTTCGACACATTCCTCAAGCAGAACCCCATCCCTGGCCCGCCGCCGGACCTGGGTAGC
GAGCTTCTTGGAGCACGCTTCGTTGGACGATGGAAGAGTG
GTGCGCCCATTGACCTTGCTCCGACCGCCGATGATCCCGCTCTTGGTGCTGATTCCTCCCGCAACAACAACTTCCGTTAT
GCCTTCCCCGATGACCCGCAGACCCAAGATCGATGCCCGTTTGCGGCGCACACCCGTAAGACCAACCCCAGGGCCGACCTCGAGGACCTTTCGCCTCCCATCTCCACTGAGACGCGCCGC
ATCATCCGTCGTGGGATCCAATACGGACCTGAGGTTACTCCGCTGGAGGCCGCAAAGGGCCAGACGGAGAACAACCGTGGCCTCATCTTCGTCGCCTATCAGAGCAACATTGTGAACGGA
TTCCAGTTCATCCAGCACA
GCTGGGCGAACAATACTGGCTTCCCCATTGACAAGCCCATAACGCCTGGCTTCGACCCCATCATCGGCCAGGCAACGGACCCCTCGTCGCGCACGCTATCT
GGTACGAACCCCAATGCACAGAGCAACACGCTCGCTCTGCCTACGCAGTGGGTCGTGCCTCAGGGTGGAGAATACTTCATCTCGCCGTCCATCCCTGCTCTCAAGAGTACCTTTGCGGTC
TCG

Retrieve as FASTA