Entry information : FmeDyPrx01 (Fomme-DyP1)
Entry ID 9893
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: FmeDyPrx01 (Fomme-DyP1)
Name (synonym) FmeDyPrx01 (Fomme-DyP1)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Hymenochaetaceae Fomitiporia
Organism Fomitiporia mediterranea    [TaxId: 208960 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value FmeDyPrx01
start..stop
S start..stop
FmeDyPrx03 583 0 5..469 2..473
FmeDyPrx02 580 0 18..469 17..470
BbotDyPrx03 568 0 6..469 37..518
TvDyPrx01_other 471 3e-164 9..468 7..483
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2342199..2342247 49 N° 2 2342305..2342314 10 N° 3 2342375..2342594 220 N° 4 2342662..2342814 153
N° 5 2342879..2343013 135 N° 6 2343075..2343229 155 N° 7 2343299..2343583 285 N° 8 2343652..2343833 182
N° 9 2343896..2343958 63 N° 10 2344026..2344183 158  
join(2342199..2342247,2342305..2342314,2342375..2342594,2342662..2342814,2342879 ..2343013,2343075..2343229,2343299..2343583,2343652..2343833,2343896..2343958,23 44026..2344183)


exon

Literature and cross-references FmeDyPrx01 (Fomme-DyP1)
DNA ref. JGI genome:   scaffold_2 (2342199..2344183)
Protein sequence: FmeDyPrx01 (Fomme-DyP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   470
PWM (Da):   %s   51094.35  
PI (pH):   %s   7.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATPTWPTPQDLNDLQADVVLGIPKRAEDFIFFNIQDAAAFKKDLKELIPAITTTAQVKKIRTDITNHKQQGKTDLIKVAAINIAFSVAGLKLGITESLGDDAFNQGQLAHAQNLGDTGKTENGSFVPEWIDAFKNEIDGVVLVAGDSKISVDEGVNKVEHTFGKSIKEVFKVNGHVRPNKEKGHEHFGFKDGISFPAIDALTGHLPGQIVVDPGVLVCGTNGDTVQNRPAWAKNGSFLVYRQLQQLVPEFNKFLTDNPVNVPGLPRDKGSELLGARLFGRWKSGAPIELAPTADDPKLAEDKQRNNNFDFKDSFSDQTKCPFAAHIRKTNPRNDLIQPFGDGALKPHMIVRQSITYGPEVTPEEAHSNKTKVDRGLAFVCYQSNLANGFEFVQSWANATGFPPQKPVTPGFDPIIGQKNGQARETAGLQIDNQSANTTLPIEFVVSKGGAYFFSPSITALKTKLSA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCCCACTTGGCCGACTCCTCAGGATCTTAATGACCTTCAAGGTGAGCGGTGAACATTTGATATCTTTGTGGCATTCCACTAACGTGTCATTGCTACAGCCGACGTCGTGTGC
GTGTTATGCCGGACGAATCAATTATCATGCTGTCGCTCATTGTTTTTGTCTTACAGTCTTGGTATCCCGAAGCGTGCTGAGGACTTCATCTTCTTCAACATCCAGGATGCGGCTGCTTTC
AAGAAGGATCTCAAGGAGCTCATCCCAGCCATCACTACGACCGCACAAGTCAAGAAGATCCGCACCGACATTACCAACCACAAGCAGCAGGGCAAGACCGACTTGATCAAGGTTGCTGCC
ATCAACATTGCGTTCTCCGTTGCTGGCTTAAAGAAG
GTATTGTGCCTTTACATCGGCGTTAAAGGGCGTGTTACTGACTAATGCTATGTGCGCTGGATTATAGCTCGGCATCACCGAGTC
TCTCGGCGATGATGCGTTCAACCAAGGTCAATTAGCGCATGCGCAGAACCTTGGTGATACTGGCAAGACCGAAAACGGATCATTCGTTCCCGAATGGATCGATGCGTTCAAGAATGAAAT
CGATGGTGTTGTTTTG
GTACGTAATCTTTGTTGGATACTTGCAAGCCATTCATTGAGTTGAACTTTTATTCTTCGCACAGGTCGCTGGTGACTCCAAGATCTCCGTCGACGAGGGCGTTA
ACAAGGTTGAACATACCTTCGGCAAATCTATCAAAGAAGTCTTCAAGGTCAACGGACATGTCCGACCTAACAAGGAGAAGGGTCACGAACACTTC
GTTAGTGTCGTTAGAAGTTCATTTA
TTTTTGCATACTGACAGGGGCGTATTCACCGTATAGGGTTTCAAAGACGGGATCTCCTTCCCTGCTATTGATGCATTGACTGGTCACCTCCCTGGTCAGATCGTCGTAGACCCTGGCGTC
CTTGTTTGTGGTACCAATGGCGATACGGTCCAGAACCGACCTGCGTGGGCAAAGAACGGATCTTTCCTTGT
GTGAGTCTAATTTAATACAGCGTTTCGGTCCCTGGAATCTTGATCAATA
CTGAGACGATCAATCTGTAGATATCGTCAACTGCAGCAGCTTGTACCGGAGTTCAACAAGTTCCTCACGGACAACCCTGTCAATGTGCCAGGTCTTCCGCGTGACAAGGGAAGCGAGTTG
CTCGGTGCTAGGTTGTTCGGTCGTTGGAAGAGCGGCGCGCCCATCGAACTTGCGCCGACTGCGGATGACCCGAAGCTCGCTGAGGACAAGCAGAGGAACAATAACTTTGATTTCAAGGAC
AGCTTCTCGGACCAGACCAAGTGTCCGTTTGCTGCGCACATCCGGAAGACGAACCCTCGCAATGA
GTGAGTTGTTTGTCATTTATCTTCTGTCATGAGTTATGTTAGGTGCTCATGTTAT
GGCCACTGTATAGTCTTATCCAGCCGTTCGGTGATGGTGCATTGAAGCCTCACATGATCGTCCGCCAGAGCATTACCTATGGACCTGAAGTGACGCCTGAGGAGGCACACTCGAACAAGA
CGAAGGTCGACCGTGGACTTGCTTTCGTTTGCTACCAGAGCAACCTCGCGAACGGCTTTGAATTCGTTCAGGAAT
GTAAGTGATACAACCCATTTCAATGGTTGCATACGTTAACCGATC
GATTCGTCGTCCTTTAGCATGGGCGAACGCCACTGGTTTCCCACCACAGAAGCCCGTCACGCCTGGGTTTGACCCGATCAGTACGTCTTCATTCTCCCTTTTCTTCCGATAGTCGCGTAC
TGACGTGCATGACGTGACTGTTTTCAGTCGGCCAGAAGAACGGTCAAGCTCGCGAAACTGCTGGTTTGCAGATTGACAACCAGTCTGCGAACACAACGTTGCCGATCGAGTTTGTTGTGT
CGAAGGGAGGGGCGTACTTTTTCTCACCATCGATTACTGCGCTCAAGACGAAGTTGTCTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTCCCACTTGGCCGACTCCTCAGGATCTTAATGACCTTCAAGCCGACGTCGTTCTTGGTATCCCGAAGCGTGCTGAGGACTTCATCTTCTTCAACATCCAGGATGCGGCTGCT
TTCAAGAAGGATCTCAAGGAGCTCATCCCAGCCATCACTACGACCGCACAAGTCAAGAAGATCCGCACCGACATTACCAACCACAAGCAGCAGGGCAAGACCGACTTGATCAAGGTTGCT
GCCATCAACATTGCGTTCTCCGTTGCTGGCTTAAAGAAG
CTCGGCATCACCGAGTCTCTCGGCGATGATGCGTTCAACCAAGGTCAATTAGCGCATGCGCAGAACCTTGGTGATACTGGC
AAGACCGAAAACGGATCATTCGTTCCCGAATGGATCGATGCGTTCAAGAATGAAATCGATGGTGTTGTTTTG
GTCGCTGGTGACTCCAAGATCTCCGTCGACGAGGGCGTTAACAAGGTT
GAACATACCTTCGGCAAATCTATCAAAGAAGTCTTCAAGGTCAACGGACATGTCCGACCTAACAAGGAGAAGGGTCACGAACACTTC
GGTTTCAAAGACGGGATCTCCTTCCCTGCTATT
GATGCATTGACTGGTCACCTCCCTGGTCAGATCGTCGTAGACCCTGGCGTCCTTGTTTGTGGTACCAATGGCGATACGGTCCAGAACCGACCTGCGTGGGCAAAGAACGGATCTTTCCTT
GT
ATATCGTCAACTGCAGCAGCTTGTACCGGAGTTCAACAAGTTCCTCACGGACAACCCTGTCAATGTGCCAGGTCTTCCGCGTGACAAGGGAAGCGAGTTGCTCGGTGCTAGGTTGTTC
GGTCGTTGGAAGAGCGGCGCGCCCATCGAACTTGCGCCGACTGCGGATGACCCGAAGCTCGCTGAGGACAAGCAGAGGAACAATAACTTTGATTTCAAGGACAGCTTCTCGGACCAGACC
AAGTGTCCGTTTGCTGCGCACATCCGGAAGACGAACCCTCGCAATGA
TCTTATCCAGCCGTTCGGTGATGGTGCATTGAAGCCTCACATGATCGTCCGCCAGAGCATTACCTATGGACCT
GAAGTGACGCCTGAGGAGGCACACTCGAACAAGACGAAGGTCGACCGTGGACTTGCTTTCGTTTGCTACCAGAGCAACCTCGCGAACGGCTTTGAATTCGTTCAGGAAT
CATGGGCGAAC
GCCACTGGTTTCCCACCACAGAAGCCCGTCACGCCTGGGTTTGACCCGATCA
TCGGCCAGAAGAACGGTCAAGCTCGCGAAACTGCTGGTTTGCAGATTGACAACCAGTCTGCGAACACA
ACGTTGCCGATCGAGTTTGTTGTGTCGAAGGGAGGGGCGTACTTTTTCTCACCATCGATTACTGCGCTCAAGACGAAGTTGTCTGCTTGA

Retrieve as FASTA