Entry information : GsppDyPrx01
Entry ID 9896
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: GsppDyPrx01
Name GsppDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppDyPrx01
start..stop
S start..stop
GsppDyPrx02 749 0 1..487 1..489
DsDyPrx 722 0 1..487 1..483
GsppDyPrx03 664 0 8..487 16..492
TvDyPrx01 592 0 1..487 1..484
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1335498..1335550 53 N° 2 1335610..1335847 238 N° 3 1335906..1336201 296 N° 4 1336253..1336557 305
N° 5 1336617..1336887 271 N° 6 1336949..1337010 62 N° 7 1337069..1337307 239  
join(1335498..1335550,1335610..1335847,1335906..1336201,1336253..1336557,1336617 ..1336887,1336949..1337010,1337069..1337307)


exon

Literature and cross-references GsppDyPrx01
DNA ref. JGI genome:   scaffold_13 (1335498..1337307)
Protein sequence: GsppDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   487
PWM (Da):   %s   52790.46  
PI (pH):   %s   9.67
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTPARAPLNPANVQGDILVGLPKKVQHYLLFQIDDDVTAFRRRLSLLVPHITTTSHVQHDRAKIAAHKKVAAALSDAPKLLQLSSINIAFSHAGLVLGIHDDIGDAAFTSGQLADAKNLGDPGTTVDGKFNPNWIHAFKQAIHGVIIISGESDLTVDATHATVLGIFNIGARITLHEVSTLKGVVRPGAQKGHEHFGFLDGISQPAVKDFDTKPNPGQKTVRQGIIFCGREHDVDANNNDKPIVRPNWALDGSFLTLRYLFQLVPEFDSFLKASADPMKGFTPDLLGARLVGRWKGAPVDLFPLHDNPAAGRDPLQNNNFQYSFPEDPKTQDRCPFAGHTRKTNPRADLEGLGFSTESRQIIRRGVPFGPEVTAQETSRGKTEKGRGLIFVAYSSSITNGFKFIQSWANDTGFPIQKPVTPGVDPLIGQNNNGPNGIGPRSMSGADPKNQSATLSLLVEWVIPRGGEYFFTPSIPALRRTFALA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCCTGCCAGAGCACCACTTAACCCGGCCAACGTCCAGGGCGATATCCTGTAGGACTCATTTGAGCACATTTTCATTTTCGTTCTATGCCTTACGAATCGTACCGTAGTGTCGGCC
TCCCGAAAAAGGTCCAGCACTATCTGCTTTTCCAGATTGACGACGATGTTACCGCGTTTAGGAGGCGGCTCAGCCTACTGGTTCCCCACATCACCACCACTTCGCATGTCCAGCACGACC
GCGCGAAGATCGCCGCTCACAAGAAGGTGGCTGCTGCGCTCAGCGATGCCCCGAAACTCCTGCAGTTGTCCAGCATCAACATCGCCTTCTCCCATGCCGGACTTGTGAAG
GTAGAATTCC
ATGATGGTTCAACACTGGGATAGATGCCAGTACTGACATGCTGTACAGCTGGGGATTCACGACGACATTGGTGATGCCGCATTCACCAGCGGCCAGCTCGCCGACGCAAAGAATCTTGGT
GACCCCGGCACTACCGTCGACGGCAAGTTCAACCCCAACTGGATCCACGCCTTCAAACAGGCCATTCATGGAGTCATAATCATCTCGGGCGAGTCCGATCTGACCGTAGATGCGACCCAT
GCCACCGTGTTAGGCATTTTCAACATCGGCGCCCGGATCACGCTCCACGAAGTTTCCACTCTGAAGGGTGTCGTCCGTCCTGGAGCACAGAAGGGCCATGAGCA
GTAAGCATTTGCTCCT
ACACATTGATACTAAATCTAAGCTGCTCCCATCAGTTTCGGCTTCCTGGATGGCATTTCTCAGCCCGCGGTCAAGGACTTCGACACCAAGCCTAACCCTGGTCAGAAGACCGTCCGCCAG
GGCATCATTTTCTGTGGGCGTGAGCACGATGTGGACGCTAACAACAACGACAAGCCCATCGTTCGACCTAATTGGGCCTTGGACGGTAGTTTCCTCACTCTCCGGTACCTCTTCCAGCTT
GTCCCGGAGTTCGACAGCTTCTTGAAGGCTAGCGCGGATCCGATGAAGGGCTTCACCCCTGACCTCCTTGGTGCCCGTCTCGTTGGACGGTGGAAGAGCG
GTACGTTAGCATTCTTGGTT
ATTCAAATAAGACGTACTCGAGACTTATCATGCCACCAGGCGCTCCTGTTGACCTTTTCCCCTTACACGACAACCCGGCCGCAGGTCGGGATCCCCTTCAGAACAACAACTTCCAGTATA
GCTTCCCAGAAGACCCCAAGACCCAAGACCGCTGCCCATTTGCAGGGCACACCCGTAAGACTAACCCGCGTGCCGATCTCGAGGGACTCGGTTTCTCCACCGAGAGCAGGCAAATCATCC
GCCGTGGTGTTCCTTTCGGACCGGAAGTTACTGCTCAAGAGACTTCGAGAGGAAAGACAGAGAAGGGCCG
GTAAGTACCTTATCCTGGTTTATTTTGATGTTTGATCCATCCATTGACGA
ACACATTCCAGTGGCCTCATCTTCGTTGCGTATTCGTCTAGTATCACAAATGGCTTCAAATTCATACAACAGAGTGTGTATCTCAGAGGGCTCCGGTGTGCACGGTTGAAGTTGCTGATC
CATCGTATCAGGCTGGGCGAACGATACCGGGTTTCCGATCCAAAAGCCAGTCACACCTGGTGTCGACCCCCTCATCGGCCAGAACAACAATGGCCCGAACGGTATCGGTCCGCGCTCCAT
GTCTGGTGCAGACCCCAAGAACCAGAGCGCGACTCTGTCGCTCCTAGTTGAGTGGGTGATCCCGAGGGGTGGCGAATATTTCTTCACACCTTCCATCCCTGCTCTCCGTCGCACCTTTGC
GTTAGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTCCTGCCAGAGCACCACTTAACCCGGCCAACGTCCAGGGCGATATCCTTGTCGGCCTCCCGAAAAAGGTCCAGCACTATCTGCTTTTCCAGATTGACGACGATGTTACCGCGTTT
AGGAGGCGGCTCAGCCTACTGGTTCCCCACATCACCACCACTTCGCATGTCCAGCACGACCGCGCGAAGATCGCCGCTCACAAGAAGGTGGCTGCTGCGCTCAGCGATGCCCCGAAACTC
CTGCAGTTGTCCAGCATCAACATCGCCTTCTCCCATGCCGGACTTGTGAAG
CTGGGGATTCACGACGACATTGGTGATGCCGCATTCACCAGCGGCCAGCTCGCCGACGCAAAGAATCTT
GGTGACCCCGGCACTACCGTCGACGGCAAGTTCAACCCCAACTGGATCCACGCCTTCAAACAGGCCATTCATGGAGTCATAATCATCTCGGGCGAGTCCGATCTGACCGTAGATGCGACC
CATGCCACCGTGTTAGGCATTTTCAACATCGGCGCCCGGATCACGCTCCACGAAGTTTCCACTCTGAAGGGTGTCGTCCGTCCTGGAGCACAGAAGGGCCATGAGCA
TTTCGGCTTCCTG
GATGGCATTTCTCAGCCCGCGGTCAAGGACTTCGACACCAAGCCTAACCCTGGTCAGAAGACCGTCCGCCAGGGCATCATTTTCTGTGGGCGTGAGCACGATGTGGACGCTAACAACAAC
GACAAGCCCATCGTTCGACCTAATTGGGCCTTGGACGGTAGTTTCCTCACTCTCCGGTACCTCTTCCAGCTTGTCCCGGAGTTCGACAGCTTCTTGAAGGCTAGCGCGGATCCGATGAAG
GGCTTCACCCCTGACCTCCTTGGTGCCCGTCTCGTTGGACGGTGGAAGAGCG
GCGCTCCTGTTGACCTTTTCCCCTTACACGACAACCCGGCCGCAGGTCGGGATCCCCTTCAGAACAAC
AACTTCCAGTATAGCTTCCCAGAAGACCCCAAGACCCAAGACCGCTGCCCATTTGCAGGGCACACCCGTAAGACTAACCCGCGTGCCGATCTCGAGGGACTCGGTTTCTCCACCGAGAGC
AGGCAAATCATCCGCCGTGGTGTTCCTTTCGGACCGGAAGTTACTGCTCAAGAGACTTCGAGAGGAAAGACAGAGAAGGGCCG
TGGCCTCATCTTCGTTGCGTATTCGTCTAGTATCACA
AATGGCTTCAAATTCATACAACAGA
GCTGGGCGAACGATACCGGGTTTCCGATCCAAAAGCCAGTCACACCTGGTGTCGACCCCCTCATCGGCCAGAACAACAATGGCCCGAACGGTATC
GGTCCGCGCTCCATGTCTGGTGCAGACCCCAAGAACCAGAGCGCGACTCTGTCGCTCCTAGTTGAGTGGGTGATCCCGAGGGGTGGCGAATATTTCTTCACACCTTCCATCCCTGCTCTC
CGTCGCACCTTTGCGTTAGCATGA

Retrieve as FASTA