Entry information : GsppDyPrx02
Entry ID 9897
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: GsppDyPrx02
Name GsppDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppDyPrx02
start..stop
S start..stop
DsDyPrx 772 0 1..489 1..483
GsppDyPrx01 768 0 1..489 1..487
GsppDyPrx03 692 0 6..489 14..492
TvDyPrx01 628 0 1..489 1..484
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 142899..142951 53 N° 2 142602..142839 238 N° 3 142250..142548 299 N° 4 141889..142196 308
N° 5 141562..141832 271 N° 6 141444..141505 62 N° 7 141152..141390 239  
complement(join(141152..141390,141444..141505,141562..141832,141889..142196,1422 50..142548,142602..142839,142899..142951))


exon

Literature and cross-references GsppDyPrx02
DNA ref. JGI genome:   scaffold_15 (142951..141152)
Protein sequence: GsppDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   489
PWM (Da):   %s   53028.21  
PI (pH):   %s   7.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASTLPPFNPANIQGDILAGLPKKVQHYLFFQIDDDVTAFRKRLRLLIPLITTTAQVQDDRAKIAANKKKAAEQGKAPELLHLSGVNIAFSQFGLTLGLKDNMGDTAFTSGQLADAANLGDAGANDANNQFVPDWINAFKNQIHGVVIISGDCDLTVTATQATVLGIFNIGARITLHEVLTLKGVVRPGDEKGHEHFGFLDGISQPAVKDFDTKPNPGQETVRQGVILCGREGDVVAGSSPEQPFTRPAWALDGSFLALRYLFQLVPEFDNFLKASADPTKGFTSDLLGARLVGRWKGAPVDLFPLADNPDAGKDPLQNNNFRYDFPDDFKTQDRCPFAGHTRKTNPRNDLESLGFSTENRRIIRRGVQFGPELTREEVSSSKTLHGRGLIFVAYCGSITNGFQFIQSWANNTGFPIQKPIVPGFDPIIGQNNQGPNGIGPRSMSGANPNDQTATLSLPTEWVVPKGGEYFFSPSIPALRNTFALA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCACTCTCCCCCCCTTCAACCCCGCTAACATCCAGGGCGACATCCTGTAGGTTTCCACCATGACCTAGATTACCCCTCGCACTGTGAACTGATCGCTGTACCCAGTGCCGGCC
TCCCGAAGAAGGTCCAGCACTACCTGTTCTTCCAGATCGATGACGATGTCACCGCATTCAGGAAGCGGCTCCGTCTGTTGATCCCCCTCATCACTACCACCGCGCAAGTTCAGGATGACC
GCGCTAAGATCGCCGCTAACAAGAAGAAGGCGGCGGAGCAAGGCAAGGCTCCCGAGCTCTTGCATCTGTCAGGCGTCAACATTGCGTTCTCTCAATTCGGTCTTACCAAG
GTAAACGGTC
TGATCGCTGTTGACGGAGTCTTTCGCACTAACATCTTGCTAAGTTGGGTCTTAAAGACAACATGGGCGACACCGCCTTCACTAGTGGCCAGCTCGCGGACGCTGCCAACCTCGGGGACGC
CGGCGCGAACGACGCCAACAATCAGTTCGTTCCCGACTGGATCAACGCGTTCAAGAACCAGATTCATGGCGTCGTCATCATCTCTGGTGATTGTGACCTGACCGTCACTGCAACTCAAGC
CACCGTGTTGGGCATCTTCAACATCGGGGCCCGGATCACACTCCATGAGGTTCTCACTCTGAAAGGAGTCGTTCGTCCCGGCGACGAGAAGGGCCACGAGCA
GTAAGACCTCTCTTGTCA
TCACACCAACTTCATAACTAAGTTGCTCTCACCAGCTTCGGCTTTTTGGATGGGATTTCCCAACCCGCAGTCAAGGACTTCGACACCAAACCGAACCCCGGCCAGGAGACTGTCAGACAG
GGCGTCATTCTGTGCGGGCGTGAGGGCGATGTGGTCGCGGGGTCTAGCCCTGAGCAACCATTCACTCGTCCTGCCTGGGCATTGGACGGCAGTTTTCTTGCTCTCCGGTACCTCTTCCAA
CTCGTCCCTGAGTTTGATAACTTCTTGAAGGCCAGCGCGGATCCCACGAAGGGCTTCACCTCTGATCTCCTTGGTGCCCGTCTCGTCGGTCGCTGGAAGAGTG
GTATGTGGGGCTTTGTT
AACGAAGCGGGGTAGGCATGCTCACCTGATTGGCATTAGGTGCCCCTGTGGACCTCTTCCCCTTGGCAGACAACCCCGACGCTGGAAAAGACCCCCTTCAGAACAACAACTTCAGGTACG
ACTTCCCGGATGACTTCAAGACCCAGGACCGCTGCCCATTCGCGGGGCACACGCGCAAGACCAACCCACGTAACGACCTTGAGTCGCTCGGTTTCTCCACGGAGAACCGGCGCATCATCC
GCCGTGGTGTCCAATTCGGACCGGAACTCACCCGCGAGGAGGTTTCGAGCAGCAAGACGCTTCACGGCCG
GTAAGCCCTCTATCGGCATTGAGAGACCGAGCTTTTCGTTGACGAAGACG
TCGCAGTGGTCTCATCTTCGTGGCGTACTGCGGTAGCATCACGAACGGCTTCCAATTCATCCAGAAGAGTGCGTAGCTTCAATACTCGCACATGTTAAAGTTTGCTTACGCGTTGTTATA
GGCTGGGCGAACAACACCGGCTTCCCTATCCAGAAGCCAATCGTCCCGGGCTTCGACCCCATCATTGGCCAGAACAACCAAGGTCCGAACGGTATTGGTCCGCGCAGCATGTCAGGCGCG
AACCCTAACGACCAGACCGCGACGCTCTCGCTGCCCACAGAGTGGGTCGTTCCCAAGGGTGGAGAGTACTTCTTCTCGCCTTCTATCCCAGCTCTCCGCAACACCTTCGCGTTGGCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCCACTCTCCCCCCCTTCAACCCCGCTAACATCCAGGGCGACATCCTTGCCGGCCTCCCGAAGAAGGTCCAGCACTACCTGTTCTTCCAGATCGATGACGATGTCACCGCATTC
AGGAAGCGGCTCCGTCTGTTGATCCCCCTCATCACTACCACCGCGCAAGTTCAGGATGACCGCGCTAAGATCGCCGCTAACAAGAAGAAGGCGGCGGAGCAAGGCAAGGCTCCCGAGCTC
TTGCATCTGTCAGGCGTCAACATTGCGTTCTCTCAATTCGGTCTTACCAAG
TTGGGTCTTAAAGACAACATGGGCGACACCGCCTTCACTAGTGGCCAGCTCGCGGACGCTGCCAACCTC
GGGGACGCCGGCGCGAACGACGCCAACAATCAGTTCGTTCCCGACTGGATCAACGCGTTCAAGAACCAGATTCATGGCGTCGTCATCATCTCTGGTGATTGTGACCTGACCGTCACTGCA
ACTCAAGCCACCGTGTTGGGCATCTTCAACATCGGGGCCCGGATCACACTCCATGAGGTTCTCACTCTGAAAGGAGTCGTTCGTCCCGGCGACGAGAAGGGCCACGAGCA
CTTCGGCTTT
TTGGATGGGATTTCCCAACCCGCAGTCAAGGACTTCGACACCAAACCGAACCCCGGCCAGGAGACTGTCAGACAGGGCGTCATTCTGTGCGGGCGTGAGGGCGATGTGGTCGCGGGGTCT
AGCCCTGAGCAACCATTCACTCGTCCTGCCTGGGCATTGGACGGCAGTTTTCTTGCTCTCCGGTACCTCTTCCAACTCGTCCCTGAGTTTGATAACTTCTTGAAGGCCAGCGCGGATCCC
ACGAAGGGCTTCACCTCTGATCTCCTTGGTGCCCGTCTCGTCGGTCGCTGGAAGAGTG
GTGCCCCTGTGGACCTCTTCCCCTTGGCAGACAACCCCGACGCTGGAAAAGACCCCCTTCAG
AACAACAACTTCAGGTACGACTTCCCGGATGACTTCAAGACCCAGGACCGCTGCCCATTCGCGGGGCACACGCGCAAGACCAACCCACGTAACGACCTTGAGTCGCTCGGTTTCTCCACG
GAGAACCGGCGCATCATCCGCCGTGGTGTCCAATTCGGACCGGAACTCACCCGCGAGGAGGTTTCGAGCAGCAAGACGCTTCACGGCCG
TGGTCTCATCTTCGTGGCGTACTGCGGTAGC
ATCACGAACGGCTTCCAATTCATCCAGAAGA
GCTGGGCGAACAACACCGGCTTCCCTATCCAGAAGCCAATCGTCCCGGGCTTCGACCCCATCATTGGCCAGAACAACCAAGGTCCGAAC
GGTATTGGTCCGCGCAGCATGTCAGGCGCGAACCCTAACGACCAGACCGCGACGCTCTCGCTGCCCACAGAGTGGGTCGTTCCCAAGGGTGGAGAGTACTTCTTCTCGCCTTCTATCCCA
GCTCTCCGCAACACCTTCGCGTTGGCGTAA

Retrieve as FASTA