Entry information : GsppDyPrx03
Entry ID 9898
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-22 (Catherine Mathe (Scipio))
Peroxidase information: GsppDyPrx03
Name GsppDyPrx03
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppDyPrx03
start..stop
S start..stop
GsppDyPrx02 678 0 11..492 3..489
GsppDyPrx01 666 0 16..492 8..487
DsDyPrx 635 0 9..492 2..483
TvDyPrx01 562 0 10..492 2..484
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 218572..218648 77 N° 2 218273..218510 238 N° 3 217921..218219 299 N° 4 217539..217846 308
N° 5 217199..217457 259 N° 6 217064..217125 62 N° 7 216759..216994 236  
complement(join(216759..216994,217064..217125,217199..217457,217539..217846,2179 21..218219,218273..218510,218572..218648))


exon

Literature and cross-references GsppDyPrx03
DNA ref. JGI genome:   scaffold_16 (218648..216759)
Protein sequence: GsppDyPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   492
PWM (Da):   %s   53291.43  
PI (pH):   %s   7.08
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSTATTTTTTTTPSFDPTNVQGDILPGLPKRVQRYVLFQIDDDVVAFRKRLNLLVPLITTTAQVQDHRAQIAAYRKAAAELGITPVLLPLSGINIAFSHSGLVLGINDNIGDAAFNAGQLADSESLGDPRAPGNSDTFVPDWINAFKSPIHGVILISGESDLTVDTTHTMVSLLFNIGFRITLHEVLTIKGSVRPGDKKSREHFGFLDGISQPAVKDFDTKPDPGQETVRQGVILCGRENDVDVNARPPKPFVRPAWALDGSFLTLRYLFQLVPEFNNFLKESADPLHGFTADLIGARLMGRWKGAPTDSFPLIDDPAAGTDPARRNNFTYDPKSQDRCPFAAHTRKTHPRADLESLGHSTENRRIIRRGIQFGPEVSADEAASGKTQQGRGLIFVAYSGSITNGFQFMQSFANDVNFPIDKQPTVPGFDPIIGQNGVDGVRVRSMTGVLPSNTGASFPLPTDWVVPKGGEYFFSPSIAALRSTIALA

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTCCACCGCCACCACCACCACCACCACCACCACACCATCCTTTGACCCCACCAACGTCCAGGGCGATATTCTGTGGGTCACAATCCTATATTTTTTGCGCTCGCACTCTCGTCTG
AGCATTTTTATTCCATAGCCCCGGCTTACCGAAGAGAGTCCAGCGCTACGTGCTCTTCCAGATCGACGACGATGTCGTCGCCTTCAGGAAGCGACTCAACCTTCTGGTCCCGCTCATCAC
CACGACCGCGCAGGTCCAGGACCACCGCGCGCAGATTGCCGCTTACAGGAAGGCAGCCGCCGAGCTGGGCATAACGCCCGTGCTCCTGCCGTTGTCAGGCATCAACATCGCATTCTCGCA
TTCTGGTCTCGTGAAG
GTAAGCTCTAACAATAATTCAGAGCGTATTTTTGACGAGCGACCTGCGCGCAGCTGGGGATCAACGATAACATCGGCGACGCTGCTTTCAACGCGGGTCAGCTT
GCTGACTCCGAGAGCCTTGGTGACCCCCGTGCGCCCGGGAACAGTGACACATTCGTGCCTGACTGGATCAACGCGTTCAAGAGCCCCATCCATGGCGTCATCCTCATCTCCGGCGAGAGC
GACTTAACTGTGGATACCACCCACACCATGGTGTCATTGCTCTTCAACATCGGTTTCCGTATCACCCTTCACGAGGTCCTTACGATTAAGGGTTCCGTCCGCCCAGGCGACAAGAAGTCT
CGTGAGCA
GTAAGCTTCCTCTTCCTCTTCGTATCACTATCAGCCAATTCCGTCTCCGATTCTGAGTGCACCCCTCCCGTCAGCTTTGGCTTCCTGGACGGGATCTCGCAGCCCGCCGTCA
AGGACTTCGACACCAAGCCCGACCCGGGCCAGGAGACGGTCCGCCAGGGCGTCATCCTGTGCGGGCGCGAGAACGACGTGGACGTGAACGCCCGGCCGCCGAAGCCGTTCGTCCGCCCCG
CATGGGCCCTCGACGGCAGCTTCCTCACGCTGCGCTACCTCTTCCAGCTCGTCCCCGAGTTCAACAACTTCTTGAAGGAGAGCGCGGACCCCCTCCACGGCTTCACCGCGGACCTCATCG
GCGCACGGCTCATGGGCCGGTGGAAGAGCG
GTACGTGCCGAGTTTTTGACGCATATATATGCAGTATGCAATCGAGCCTCGACTCACGGGATGGGGACGGGATGTGTGCAGGTGCGCCGA
CGGACAGCTTTCCGCTGATAGACGACCCGGCGGCGGGGACGGACCCGGCGCGGCGCAACAACTTCACGTACGACCCGAAAAGCCAGGACCGCTGTCCGTTCGCGGCGCACACGCGCAAGA
CGCACCCGCGCGCGGACCTCGAGTCGCTTGGGCACTCGACCGAGAACAGGCGCATCATCCGGCGCGGCATCCAGTTCGGCCCCGAGGTCTCCGCCGACGAGGCCGCGAGTGGCAAGACGC
AGCAGGGACG
GTGAGTGCCTATATATACACATCTACAGCGAGGCTGGTTGGACAACCCTCTGACCCGGGGGGCTGGGGTGTAGGGGCCTCATCTTCGTCGCGTACTCGGGGAGCATCACG
AACGGCTTCCAGTTCATGCAGAAAA
GTACGTATTTTCTTTGGCTCTCTCTCACAAGCTTGAGGTCGCTCAACTTCCTGTCGCGTGTCATAACAGGCTTTGCGAACGACGTCAACTTCCCC
ATTGACAAACAGCCTACCGTCCCGGGCTTCGACCCCATCATCGGGCAGAACGGGGTGGACGGCGTTCGCGTGCGCTCCATGACGGGCGTGCTCCCCAGCAACACGGGCGCGTCGTTCCCG
CTGCCGACCGACTGGGTCGTCCCGAAGGGCGGAGAGTACTTCTTCTCGCCGTCCATCGCTGCGCTTCGGAGCACGATCGCGTTGGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCTCCACCGCCACCACCACCACCACCACCACCACACCATCCTTTGACCCCACCAACGTCCAGGGCGATATTCTCCCCGGCTTACCGAAGAGAGTCCAGCGCTACGTGCTCTTCCAG
ATCGACGACGATGTCGTCGCCTTCAGGAAGCGACTCAACCTTCTGGTCCCGCTCATCACCACGACCGCGCAGGTCCAGGACCACCGCGCGCAGATTGCCGCTTACAGGAAGGCAGCCGCC
GAGCTGGGCATAACGCCCGTGCTCCTGCCGTTGTCAGGCATCAACATCGCATTCTCGCATTCTGGTCTCGTGAAG
CTGGGGATCAACGATAACATCGGCGACGCTGCTTTCAACGCGGGT
CAGCTTGCTGACTCCGAGAGCCTTGGTGACCCCCGTGCGCCCGGGAACAGTGACACATTCGTGCCTGACTGGATCAACGCGTTCAAGAGCCCCATCCATGGCGTCATCCTCATCTCCGGC
GAGAGCGACTTAACTGTGGATACCACCCACACCATGGTGTCATTGCTCTTCAACATCGGTTTCCGTATCACCCTTCACGAGGTCCTTACGATTAAGGGTTCCGTCCGCCCAGGCGACAAG
AAGTCTCGTGAGCA
CTTTGGCTTCCTGGACGGGATCTCGCAGCCCGCCGTCAAGGACTTCGACACCAAGCCCGACCCGGGCCAGGAGACGGTCCGCCAGGGCGTCATCCTGTGCGGGCGC
GAGAACGACGTGGACGTGAACGCCCGGCCGCCGAAGCCGTTCGTCCGCCCCGCATGGGCCCTCGACGGCAGCTTCCTCACGCTGCGCTACCTCTTCCAGCTCGTCCCCGAGTTCAACAAC
TTCTTGAAGGAGAGCGCGGACCCCCTCCACGGCTTCACCGCGGACCTCATCGGCGCACGGCTCATGGGCCGGTGGAAGAGCG
GTGCGCCGACGGACAGCTTTCCGCTGATAGACGACCCG
GCGGCGGGGACGGACCCGGCGCGGCGCAACAACTTCACGTACGACCCGAAAAGCCAGGACCGCTGTCCGTTCGCGGCGCACACGCGCAAGACGCACCCGCGCGCGGACCTCGAGTCGCTT
GGGCACTCGACCGAGAACAGGCGCATCATCCGGCGCGGCATCCAGTTCGGCCCCGAGGTCTCCGCCGACGAGGCCGCGAGTGGCAAGACGCAGCAGGGACG
GGGCCTCATCTTCGTCGCG
TACTCGGGGAGCATCACGAACGGCTTCCAGTTCATGCAGAAAA
GCTTTGCGAACGACGTCAACTTCCCCATTGACAAACAGCCTACCGTCCCGGGCTTCGACCCCATCATCGGGCAGAAC
GGGGTGGACGGCGTTCGCGTGCGCTCCATGACGGGCGTGCTCCCCAGCAACACGGGCGCGTCGTTCCCGCTGCCGACCGACTGGGTCGTCCCGAAGGGCGGAGAGTACTTCTTCTCGCCG
TCCATCGCTGCGCTTCGGAGCACGATCGCGTTGGCTTGA

Retrieve as FASTA