Entry information : JargDyPrx
Entry ID 9899
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: JargDyPrx
Name JargDyPrx
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Jaapiaceae Jaapia
Organism Jaapia argillacea    [TaxId: 202697 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value JargDyPrx
start..stop
S start..stop
HanDyPrx01 536 0 4..476 3..481
ShirDyPrx02 533 0 1..476 1..485
CsuDyPrx01 524 0 2..476 3..479
PoDyPrx04_PC15 504 1e-176 7..476 4..488
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 856278..856345 68 N° 2 856403..856625 223 N° 3 856690..856964 275 N° 4 857020..857315 296
N° 5 857378..857710 333 N° 6 857764..858008 245  
join(856278..856345,856403..856625,856690..856964,857020..857315,857378..857710, 857764..858008)


exon

Literature and cross-references JargDyPrx
DNA ref. JGI genome:   scaffold_8 (856278..858008)
Protein sequence: JargDyPrx
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   480
PWM (Da):   %s   52245.08  
PI (pH):   %s   6.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSQTPLPAPPTHLDLSNIQRDILGGLPKRTETCIFFKISDDVDAFRKHLFQLIPHITTVSQVQKDQNAIKEHRRQNQPGLFPLAGLNIAFSQAGLVLGVTDDIKDSAFTAGQLADAPNLQDVPISWDLAFKRVIHGVILVTGDSHESVDKIIQHVEALFGVHLPHATILEVLRIRGDVRPGAEKGHEHFGFNDGISQPGVQGFDKQLNPGQVAVKPGVILVGEDGDSVTGRPTWAKDGSFLVFRRLAQLVPEFNQFLADNPIVLPGLSPEQGSELLGARLVGRWKGAPVDITPLQDDPALGNDPTRNNNFSYAGEQDSETRCPFAAHTRKTNPRDDLEQLTPPTSVDPFRIIRRAIPYGPELSKGEIAEKKTIHDRGLLFICYQSNIENGFQFIQKNWANNPAFPPPPPNPPKAIQPGFDPIIGQAAGAAARTMSGDQPGSQASQLSLPIEFVISRGGEYFFTPSISALRNTLARHA

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGACCCCTCTACCGGCTCCTCCAACTCACCTTGATCTATCCAACATTCAAAGAGACATTCTGTATGTCTACTTCGTCTTGCCTTACCTTTGATTTCATTCCAACGCATCTGTT
TCCAGCGGAGGTCTTCCCAAGAGGACAGAAACCTGTATCTTCTTCAAGATCTCAGATGATGTCGATGCCTTTCGCAAGCATCTCTTTCAGCTAATCCCTCATATCACGACGGTCAGCCAA
GTGCAGAAGGACCAAAATGCCATCAAAGAACACAGGAGGCAGAACCAACCAGGTCTTTTCCCGCTTGCTGGGCTGAACATTGCATTCTCCCAGGCTGGCCTTGTAAAG
GTAAACTCTTTG
TTGCAATTTTTACCACTGGACCTTCTCTGACCTGAAATTTTTGTGTCGATAGTTGGGAGTCACCGACGATATTAAGGACTCAGCATTTACCGCTGGCCAATTGGCCGATGCTCCCAACCT
ACAAGATGTCCCCATATCCTGGGACCTTGCCTTTAAGAGAGTAATTCACGGCGTGATTCTGGTTACTGGCGATTCCCACGAGTCGGTTGATAAGATTATCCAGCATGTCGAAGCATTGTT
TGGGGTTCATCTTCCTCATGCCACCATTCTGGAGGTCCTCAGAATCAGAGGTGACGTCCGACCTGGTGCCGAGAAGGGTCACGAGCA
GTGTGTTATTTGAACCCTCTTTATCCACCTGTC
GTTTCTAATCACGCCACTTCAGCTTCGGGTTTAACGACGGAATCTCTCAGCCTGGTGTTCAAGGGTTTGATAAGCAATTGAACCCAGGCCAAGTTGCCGTCAAACCAGGTGTAATACTGG
TCGGCGAGGACGGCGACTCGGTCACTGGTCGGCCAACGTGGGCCAAGGATGGTAGTTTCTTGGTCTTCAGACGTTTGGCCCAGTTGGTCCCAGAGTTCAACCAGTTCTTGGCTGACAATC
CCATCGTTCTCCCGGGATTGTCCCCAGAGCAAGGTAGCGAACTCCTGGGCGCAAGATTGGTAGGGAGATGGAAGAGTG
GTGAGTGCGATCAGAACGTTCCGTCTATCGCTACCTTGATAG
GCTAACCTCTCGCCCAACAGGTGCACCTGTCGACATCACCCCTCTGCAAGATGATCCCGCCTTGGGGAATGACCCCACTCGCAACAACAACTTCAGCTATGCAGGGGAGCAGGACTCCGA
AACCAGATGTCCCTTCGCTGCCCATACTCGCAAGACCAATCCCCGTGACGATCTCGAGCAGTTGACTCCACCTACCAGCGTGGACCCTTTCAGAATCATCCGTCGGGCGATTCCATACGG
TCCTGAACTCTCGAAGGGAGAAATAGCAGAAAAGAAGACGATCCATGATCGAGGATTACTCTTTATATGCTATCAGAGCAACATCGAAAACGGTTTCCAGTTCATCCAAAAGA
GTAGATC
TTCCTCTTTATCGATCCATTTTCCTTGGCCTCACACCTCACTATAGATTGGGCGAACAACCCTGCGTTCCCTCCACCACCGCCAAATCCCCCCAAAGCAATTCAGCCAGGGTTCGATCCG
ATAATCGGTCAGGCTGCGGGCGCAGCTGCTCGCACCATGAGCGGCGACCAACCAGGATCCCAAGCTTCGCAGCTGAGCCTACCAATCGAGTTCGTTATCTCGAGGGGTGGGGAGTACTTC
TTCACTCCTTCCATTTCTGCCTTGAGAAACACCCTCGCTCGACACGCTCGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCAGACCCCTCTACCGGCTCCTCCAACTCACCTTGATCTATCCAACATTCAAAGAGACATTCTCGGAGGTCTTCCCAAGAGGACAGAAACCTGTATCTTCTTCAAGATCTCAGAT
GATGTCGATGCCTTTCGCAAGCATCTCTTTCAGCTAATCCCTCATATCACGACGGTCAGCCAAGTGCAGAAGGACCAAAATGCCATCAAAGAACACAGGAGGCAGAACCAACCAGGTCTT
TTCCCGCTTGCTGGGCTGAACATTGCATTCTCCCAGGCTGGCCTTGTAAAG
TTGGGAGTCACCGACGATATTAAGGACTCAGCATTTACCGCTGGCCAATTGGCCGATGCTCCCAACCTA
CAAGATGTCCCCATATCCTGGGACCTTGCCTTTAAGAGAGTAATTCACGGCGTGATTCTGGTTACTGGCGATTCCCACGAGTCGGTTGATAAGATTATCCAGCATGTCGAAGCATTGTTT
GGGGTTCATCTTCCTCATGCCACCATTCTGGAGGTCCTCAGAATCAGAGGTGACGTCCGACCTGGTGCCGAGAAGGGTCACGAGCA
CTTCGGGTTTAACGACGGAATCTCTCAGCCTGGT
GTTCAAGGGTTTGATAAGCAATTGAACCCAGGCCAAGTTGCCGTCAAACCAGGTGTAATACTGGTCGGCGAGGACGGCGACTCGGTCACTGGTCGGCCAACGTGGGCCAAGGATGGTAGT
TTCTTGGTCTTCAGACGTTTGGCCCAGTTGGTCCCAGAGTTCAACCAGTTCTTGGCTGACAATCCCATCGTTCTCCCGGGATTGTCCCCAGAGCAAGGTAGCGAACTCCTGGGCGCAAGA
TTGGTAGGGAGATGGAAGAGTG
GTGCACCTGTCGACATCACCCCTCTGCAAGATGATCCCGCCTTGGGGAATGACCCCACTCGCAACAACAACTTCAGCTATGCAGGGGAGCAGGACTCC
GAAACCAGATGTCCCTTCGCTGCCCATACTCGCAAGACCAATCCCCGTGACGATCTCGAGCAGTTGACTCCACCTACCAGCGTGGACCCTTTCAGAATCATCCGTCGGGCGATTCCATAC
GGTCCTGAACTCTCGAAGGGAGAAATAGCAGAAAAGAAGACGATCCATGATCGAGGATTACTCTTTATATGCTATCAGAGCAACATCGAAAACGGTTTCCAGTTCATCCAAAAGA
ATTGG
GCGAACAACCCTGCGTTCCCTCCACCACCGCCAAATCCCCCCAAAGCAATTCAGCCAGGGTTCGATCCGATAATCGGTCAGGCTGCGGGCGCAGCTGCTCGCACCATGAGCGGCGACCAA
CCAGGATCCCAAGCTTCGCAGCTGAGCCTACCAATCGAGTTCGTTATCTCGAGGGGTGGGGAGTACTTCTTCACTCCTTCCATTTCTGCCTTGAGAAACACCCTCGCTCGACACGCTCGT

Retrieve as FASTA