Entry information : AtPrx18 (At2g24800 / PER18 / AtperoxP18)
Entry ID 99
Creation 2006-02-02 (Filippo Passardi)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information: AtPrx18 (At2g24800 / PER18 / AtperoxP18)
Name (synonym) AtPrx18 (At2g24800 / PER18 / AtperoxP18)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue types Embryos
Inflorescences
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtPrx18
start..stop
S start..stop
AlyPrx18 627 0 1..329 1..329
AhalPrx25 620 0 1..329 1..329
BstrPrx63 619 0 1..329 1..332
CrubPrx55 601 0 1..329 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10572343..10572570 228 N° 2 10572072..10572251 180 N° 3 10571754..10571919 166 N° 4 10571255..10571670 416
complement(join(10571255..10571670,10571754..10571919,10572072..10572251,1057234 3..10572570))


exon

Literature and cross-references AtPrx18 (At2g24800 / PER18 / AtperoxP18)
Literature Kumar Vajinder; Thakare Dhiraj R.; Saha Dip N.; et al. Characterization of upstream sequences of the peroxidase gene, Atprx18 of Arabidopsis thaliana. JPBB 21, 1, 121-127 2012.
Protein ref. UniProtKB:   Q9SK52
DNA ref. Phytozome 12:   Chr2 (10572570..10571255)
mRNA ref. GenBank:   NM_128039
Cluster/Prediction ref. Phytozome Gene 12:   19639018 UniGene:   At.52898
Omic ref. AtProteome:   At2g24800 ATTED-II:   At2g24800 e-FP Browser:   At2g24800 ePlant:   At2g24800 Genevestigator:   At2g24800 TAIR:   At2g24800
Protein sequence: AtPrx18 (At2g24800 / PER18 / AtperoxP18)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (300)
PWM (Da):   %s   35503.9 (32302.1)  
PI (pH):   %s   5.03 (4.80) Peptide Signal:   %s   cut: 30 range:30-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALQFFSCKPKYTFLSSLLLLLLLSSSVAELSFNFYAGSCPGAELIVRNTVRSASSSDPSVLGKLLRLIFHDCFVQGCDGSVLIRGNGTERSDPGNASLGGFAVIESVKNILEIFCPGTVSCADILVLAARDAVEALGGPVVPIPTGRRDGRVSMAANVRPNIIDTDFTVDKMINIFSSKGLSVHDLVVLSGAHTIGAAHCNTFNSRFKLDPKGNLELIDASLDNSYAQTLVNKCSSSLDPTTTVVDNDPETSSTFDNQYYKNLLAHKGLFQTDSALMEDDRTRKIVEILANDQESFFDRWTESFLKMSLMGVRVGEEGEIRRSCSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns), 1 EST and 1 cDNA.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGTCTCCGGT TTACTGAAAG CGCCGGTGCA ACAATACTCC GGTTTGTTAA AAGCCTCACA AGCACTCTTA CACGCCACAA CACCCGATGA GCCGTTAACG CGTAGCTCTT TTGGACAAAT  GGCATTCACG TCCGAAACAC ATCCCGCGGT TTTACAATTG CCTGAGCCAC CTTGTGGTGT GATTTTCACC TGAACGTTGT AACCGTCGAC GAGACTCACG TCGTAAGAAT CTTGTACGGT  GTATTTCTTT CCAGAGGAGC CGATTCTGAA TTCTGCTAGT GTGGCTGGTG GTGCTCCTCT TGCACCGGTG CATTTTTACA TTTTCTGGAA CCAGAGGCGT TGAAGTTGCA GCCCGTTCGA  CCCCAGATTC GACCAGACCA ACCTGGAGAA ACGGTTAAGT TTACAGAAGA ACCTGAAGCT AAGGCAAATC CGCCGCCGCG GAGTAGTGTG CGGTTTGCGG TTAGGATTCC GGGCCACACA  GTAAAGTTGC AGCGGTTTGA TAAAGTGAAG ACGGTGCCGG AGACAATAGA AATTGTACCT TGAAGAATAT ACAATTAAAA AAAAATTACT AGGACGGACA ACAAAAAAAA ATTATCAGAT  AAATTATTAA ATCAAAGTAG TCATCTTAAA ATGTTGGAAA TGTTTTATGT ATACATGTGG CTATGATGAA GGAGAAGAAG AGAAGATGTA ATTTGGAGAA AATAGCCATT GTTAATCTGA  GTATTGAAAA GTTGAAGTTG TGATGATTAG TGAAAGTTGA TGGTGAGGAT CCTCTGTTTA TAGTGTTTTT CTTTTCTTTA GAAACAAATC CATTAACTTA TTGTTTTGGA TACTACTACC  ATAAGTGACA CTTCATATTT TTATTTTTTT TACTTTTAAA GTTTAATGAG ATTTTGTTTC TTATTACATA AAAATCAACT TTATTAATCT TAAGGAAATC TCCGTAAGCA TTGATGTTTT  GGATTTTACA CACATTAAAA ATTAAACATT ATTTTATGAC TGTTTATTTT TTATATTAAA TATTTTTAAT AACTATAAAC TAATACTCAT TGATTGTAAT CTAATAAATT TAATCATTGC  ATCCTGAACT TTGTGATTTA TAATATCAGT CAATAAAGAA GAAAAGAAAA AAAAAACTAC AAAATTAAAG TGGAATAAAC TTAAAATGAT TAGAAAAAGA TGGAGTACAT TTTTTCTATT  ATTTTTTCAC AAAGCTTTAA ACCTAACATT AAAAAATTTG CTTGTTTTGT TTCCTTCGAA ATTATAAGAT TATTGCTTAA TTAGGTTATT GAATTCGAGT CCAAAGCCAC GACCCCCAGG  TTTTAAAATC CAAATATCTC CGTTGCTTGT TTATTTTTGT TCTATATCGA GTTTATTATC TAAAAACGAC AAACCTTTTA CTGATTTCCA CCATTTCTTG TACTTTTCAG GTTTTCTGAG  ACATGAAAGA CAAAGAATTG GCTTATCAAC AGAAACTATC AACAAATAAA GAGTTTCTGA AGCACATTAT TAGATCCTTT TGTACATTTT TCTATTTATA GATTCTCTCT TCTTTTTTTG  TATGCAAAAG TGACATATAC TATAACAAGT CAAAGAAAGA TGAATTCAAT AAGCATGAGT GATTTTTTTA AATCTTCAAA AAGAAATATC TGAAAGGTAC AAAAAAAAGT TTTCTGATTT  TTGTCACAAT AATGGAGAAA TTCATACTAT TTTAGGGTTT CTTACCCATA AAATTCACTG CATGCAGTGA TTGGATTCAC CACTTTCAAA TTCTTGTTTT GTTTGTAAAA TTGATGACTC  GATCTCATGG ATGCATGCAT AAGAGAGTAA AGAGATTGTC ATTAAGTTCT CCTGACTCAA CCATCACTAT CTCTCTCTCT CTCTGACACG AACGCACATG CATTTACAGT TTTCATTTAT 
CACAACAACT ACAACTTCTC TTCTCTCTCT CGGCTGATTA AGCAACTTCA CTTTCCATCT TCTGACAGAC ACATTAAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACGAAGATTA GACCAAGTTT CTCCTAATCA ACAATTTCTT GATTTATTTA TTTTCAACTC CAATGTAGAC AATACGAATA TTTAAAAAAG ATTAAATATT AGTAATTTTA TACAGAAGGA  GTTGCAAAAT GTAAATTTTA CTGTTAAGGA ACTTCATGCG TTTTTTTTGA ACCATTTAGG ATATTGCCAC ATGGATCGAT CTTTTATGCG TGTTTTAAGA TGGATTCGAA CCTTAATGAA  AAGTATTTTT TTAAAAACAA ACAGATAGCA ATATCATCTC CACAAAGTAT GCATTTTGAG TTGTAATAAG TAATAACGAA TTTCAAAAAT AAACTCCCGT CAAACGTTAA TGTATCCCTC  TCCTAACGAA GCAAATAGTA ATATCATCTC CACAAATTTT CCATGAATAT TGGTCAATAA ACTTTCTACC ATTGATTCCC CTAGTTCACA TCTCAAGTGA ACATTGGTAC ATTTTAATAA  TATTTCTTAA CTTATATATC ATGTTAAACT AAACTTAAAA AAAAAATAGC ATTTTCCCGA GTTGAAAGGA GATCATATGA CACGTTTGTT TATTTGTTCA TCTAACCATA ATATAAGTTC  ACTTTAATTT TTAAATAGAA ATATGTTAAG GAAAATATGC ACAAAATAAA ATAAATGAAT ATAAAACGAT CCGACCAACA AAATAAATTA AAACTTTGTC ATCCGTGCAA AATAATCTGA  AAATTTTTGA ATTCAAAATG TAAGGAAGAC AACTCCAGTC TTGGTCCAAT AGACAACCAA AACAATTGTA ATAGACCTAA CTATGCAAAC AAAGCCCAAG ACGAGTGTAA AAGCTTCTTC  AGACTTTAAC GGTAACAGAG CATCGTCGTC ATGTACTCAG CTTCGTACTG TCAAAATGTC GACTCCAGCT CACGCTACAC TCCAATTGAA GAATAGCTTC ACAGTCCTTG AATCTCCAGC 
CATGTGCAGA TGAAGACACT TGTCATTCAT CAAAACATTT 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGCAGTTTTTTTCATGCAAACCAAAATATACATTCCTCTCCTCTCTTCTTCTACTTTTGCTTCTTTCTTCTTCAGTAGCTGAGCTCTCTTTCAACTTCTACGCCGGTTCTTGT
CCTGGAGCTGAGTTAATCGTCAGAAACACCGTTAGATCTGCTTCTTCCTCTGATCCATCAGTCCTTGGGAAGCTCCTACGTCTCATCTTCCATGACTGCTTCGTCCAG
GTACATTACATT
CTCACAGGACTGCCTCTTCCTTGCATAACAAGGCATTTCCAATTTAATGAGATTTTTGTTCTTGTCATTGCTGTCTTAGGGTTGTGATGGCTCAGTGTTGATTCGAGGAAACGGTACAGA
GCGAAGCGACCCTGGGAATGCGTCTCTAGGAGGATTCGCTGTGATAGAAAGCGTCAAAAATATCCTCGAAATCTTTTGTCCCGGCACAGTCTCTTGTGCTGATATACTTGTTCTTGCCGC
AAGAGATGCAGTAGAAGCT
GTAAGAACTTCATCAAAACACACATACATAAGAAATGTTTATATATCTGAATAACTTAAACCAGACTTTTGCATAAAATGCTCTGTTTGTATCTTTATTTT
TGGTTTTTAAAACTCTGTTTCTTGTTGTTGTGAATACTATTTTTGGGACAGCTCGGAGGACCGGTAGTTCCGATACCGACAGGGAGGAGAGACGGGAGAGTCTCAATGGCAGCAAATGTC
AGACCAAACATCATAGATACCGATTTCACAGTTGATAAGATGATCAATATCTTTTCCTCTAAAGGCTTATCTGTTCATGATCTAGTTGTCCTCTCAG
GTACGTTATCTTTCTTGATATTC
AAGAAAGAGAGATCTTTCTTTAAAACAAACCTTCAATTTTCGATCTATTACGGGTCTCAGGAGCGCACACTATTGGAGCTGCGCATTGTAACACGTTCAACAGCAGGTTTAAGCTTGATC
CAAAAGGCAACTTAGAACTAATAGACGCGTCTCTCGATAACTCCTATGCGCAAACACTTGTAAACAAGTGTTCATCGTCACTAGATCCAACGACCACGGTGGTTGATAACGATCCAGAGA
CATCGTCGACGTTCGATAATCAGTACTACAAGAATCTGTTGGCTCACAAGGGTTTGTTTCAAACGGATTCAGCTCTCATGGAAGATGATCGGACGAGGAAGATTGTTGAGATTCTTGCGA
ATGATCAGGAGAGTTTTTTCGATAGATGGACTGAGTCTTTTTTGAAGATGAGTTTGATGGGAGTGAGAGTTGGTGAAGAAGGTGAGATTAGACGTTCTTGTTCTGCTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGCAGTTTTTTTCATGCAAACCAAAATATACATTCCTCTCCTCTCTTCTTCTACTTTTGCTTCTTTCTTCTTCAGTAGCTGAGCTCTCTTTCAACTTCTACGCCGGTTCTTGT
CCTGGAGCTGAGTTAATCGTCAGAAACACCGTTAGATCTGCTTCTTCCTCTGATCCATCAGTCCTTGGGAAGCTCCTACGTCTCATCTTCCATGACTGCTTCGTCCAG
GGTTGTGATGGC
TCAGTGTTGATTCGAGGAAACGGTACAGAGCGAAGCGACCCTGGGAATGCGTCTCTAGGAGGATTCGCTGTGATAGAAAGCGTCAAAAATATCCTCGAAATCTTTTGTCCCGGCACAGTC
TCTTGTGCTGATATACTTGTTCTTGCCGCAAGAGATGCAGTAGAAGCT
CTCGGAGGACCGGTAGTTCCGATACCGACAGGGAGGAGAGACGGGAGAGTCTCAATGGCAGCAAATGTCAGA
CCAAACATCATAGATACCGATTTCACAGTTGATAAGATGATCAATATCTTTTCCTCTAAAGGCTTATCTGTTCATGATCTAGTTGTCCTCTCAG
GAGCGCACACTATTGGAGCTGCGCAT
TGTAACACGTTCAACAGCAGGTTTAAGCTTGATCCAAAAGGCAACTTAGAACTAATAGACGCGTCTCTCGATAACTCCTATGCGCAAACACTTGTAAACAAGTGTTCATCGTCACTAGAT
CCAACGACCACGGTGGTTGATAACGATCCAGAGACATCGTCGACGTTCGATAATCAGTACTACAAGAATCTGTTGGCTCACAAGGGTTTGTTTCAAACGGATTCAGCTCTCATGGAAGAT
GATCGGACGAGGAAGATTGTTGAGATTCTTGCGAATGATCAGGAGAGTTTTTTCGATAGATGGACTGAGTCTTTTTTGAAGATGAGTTTGATGGGAGTGAGAGTTGGTGAAGAAGGTGAG
ATTAGACGTTCTTGTTCTGCTGTTAATTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGC AGTTTTTTTC ATGCAAACCA AAATATACAT TCCTCTCCTC TCTTCTTCTA CTTTTGCTTC TTTCTTCTTC AGTAGCTGAG CTCTCTTTCA ACTTCTACGC CGGTTCTTGT  CCTGGAGCTG AGTTAATCGT CAGAAACACC GTTAGATCTG CTTCTTCCTC TGATCCATCA GTCCTTGGGA AGCTCCTACG TCTCATCTTC CATGACTGCT TCGTCCAGGG TTGTGATGGC  TCAGTGTTGA TTCGAGGAAA CGGTACAGAG CGAAGCGACC CTGGGAATGC GTCTCTAGGA GGATTCGCTG TGATAGAAAG CGTCAAAAAT ATCCTCGAAA TCTTTTGTCC CGGCACAGTC  TCTTGTGCTG ATATACTTGT TCTTGCCGCA AGAGATGCAG TAGAAGCTCT CGGAGGACCG GTAGTTCCGA TACCGACAGG GAGGAGAGAC GGGAGAGTCT CAATGGCAGC AAATGTCAGA  CCAAACATCA TAGATACCGA TTTCACAGTT GATAAGATGA TCAATATCTT TTCCTCTAAA GGCTTATCTG TTCATGATCT AGTTGTCCTC TCAGGAGCGC ACACTATTGG AGCTGCGCAT  TGTAACACGT TCAACAGCAG GTTTAAGCTT GATCCAAAAG GCAACTTAGA ACTAATAGAC GCGTCTCTCG ATAACTCCTA TGCGCAAACA CTTGTAAACA AGTGTTCATC GTCACTAGAT  CCAACGACCA CGGTGGTTGA TAACGATCCA GAGACATCGT CGACGTTCGA TAATCAGTAC TACAAGAATC TGTTGGCTCA CAAGGGTTTG TTTCAAACGG ATTCAGCTCT CATGGAAGAT  GATCGGACGA GGAAGATTGT TGAGATTCTT GCGAATGATC AGGAGAGTTT TTTCGATAGA TGGACTGAGT CTTTTTTGAA GATGAGTTTG ATGGGAGTGA GAGTTGGTGA AGAAGGTGAG 
ATTAGACGTT CTTGTTCTGC TGTTAATTAA 

Retrieve as FASTA