Entry information : AdelDyPrx01 (DyP1)
Entry ID 9900
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx01 (DyP1)
Name (synonym) AdelDyPrx01 (DyP1)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx01
start..stop
S start..stop
AdelDyPrx10 516 0 42..495 8..465
AdelDyPrx07 504 3e-177 38..496 1..459
AdelDyPrx11 485 4e-169 34..496 37..498
AdelDyPrx08 475 4e-166 71..495 1..433
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 167698..167818 121 N° 2 167870..167951 82 N° 3 168001..168397 397 N° 4 168454..168505 52
N° 5 168557..168731 175 N° 6 168782..168902 121 N° 7 168952..169094 143 N° 8 169154..169180 27
N° 9 169228..169277 50 N° 10 169323..169444 122 N° 11 169499..169643 145 N° 12 169692..169750 59
join(167698..167818,167870..167951,168001..168397,168454..168505,168557..168731, 168782..168902,168952..169094,169154..169180,169228..169277,169323..169444,16949 9..169643,169692..169750)


exon

Literature and cross-references AdelDyPrx01 (DyP1)
DNA ref. JGI genome:   scaffold_62 (167698..169750)
Protein sequence: AdelDyPrx01 (DyP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   498 (479)
PWM (Da):   %s   53183.04 (51261.0)  
PI (pH):   %s   6.96 (6.88) Peptide Signal:   %s   cut: 19 range:19-497
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLAALLPLFSSLLTVSHATALVDPSITALLKMKRRFNMLQNIPGQVPLPAAAAVAPSLNISNIQGDILVGMKKKNELFYFFQINDAQAFRTCMRGMVSQVTSAQQLLSTSTQPAVALNVAFSQTGLAALSITDDLADNPFKRGQFLDATALGDPEKGANWDPAFKGTSIHGVFLMASDDQVLLDAQVIVLEATCGDGMTKLYSLEGAIRPGLQAGHEAFGYLDGVAQPHIDGFGQAFPGQLTVDPGVILVGETGDSQAARRPAWTKDGSFMAFRQLKQLVPEWNKFISVNAPNVTGLTRAQSVSLMGARLMGRWKSGAPVDLSPLFDNATLGADPTLNNNFDYTHDNSDLGSDQTHCPFSAHIRKTRPRADLSAPDNSIMRAGIPYGPEVTTAERTSATTASDRGLAFVSYQSQIGKGFRFVQTAWANTQTFPFGKNVTPGFDPVAGANKGHLRLMAGYNVNNQSLSLSLPTDFVIPKGGEYFFVPSISGLREVIVG*

Retrieve as FASTA  
Remarks Complete sequence from genomic (15 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCCGCGCTCCTTCCACTCTTTTCCTCTCTACTTACGGTCAGCCATGCCACGGCTCTCGTCGACCCATCTATCACTGCGCTTCTGAAGATGAAGCGTCGCTTCAACATGCTTCAA
A
GTGTGTAGTGTTTGAAACCGGTAATCACTGCCAACCCTGAACATCGCGTAGATATCCCCGGTCAGGTGCCACTCCCAGCGGCAGCGGCGGTGGCGCCGTCGCTCAATATCAGCAATATT
CAAGGCGACATTTT
GTATGGGGGAACCGCCCCACCTTCGCGTTTCTTCTGAACCGCATCATAGGGTCGGGATGAAGAAGAAGAACGAGTTATTCTACTTCTTCCAGATCAACGACGCCCA
AGCCTTCAGAACCTGCATGCGCGGCATGGTCTCACAAGTAACGAGCGCGCAGCAACTTCTCTCGACCAGTACACAGCCCGCCGTGGCTCTCAACGTCGCATTCTCCCAGACCGGTCTTGC
GGCGCTCAGCATCACCGACGACCTCGCTGACAACCCGTTCAAACGCGGCCAGTTTTTGGACGCCACAGCGCTCGGCGACCCTGAGAAAGGCGCCAACTGGGACCCGGCGTTCAAAGGGAC
GTCCATTCACGGCGTCTTCCTGATGGCCAGCGACGACCAGGTGCTTCTTGACGCGCAGGTGATTGTGCTGGAAGCGACGTGCGGCGACGGCATGACGAAG
GTGAGCATCAAGCCTGATAT
CGATGATATTATACGTCACTGACGCTCGTTCTTCAGCTGTATTCTCTCGAGGGAGCCATCCGGCCTGGCCTCCAGGCTGGCCACGAAGGCGAGTCCCGTGCATCCCCCATAGGACTGCTT
CTCATGATCAACCGTGCAGCATTTGGCTACCTGGATGGCGTTGCGCAGCCACATATTGACGGCTTTGGCCAAGCTTTTCCGGGGCAACTGACGGTCGATCCTGGGGTTATTCTCGTTGGC
GAGACCGGGGACTCTCAGGCAGCCAGGCGGCCTGCTTGGACGAAGGACGGCTCGTTCATGGCCTTCCGGCAGCT
GTGAGTAGCGCTGATCGCCCGCTGTCAAGTCCTGAACCCTGGGATC
GTAGTAAACAGCTGGTCCCCGAGTGGAACAAGTTCATCTCGGTCAACGCCCCGAATGTCACCGGCTTGACCAGAGCCCAGAGTGTCTCTCTCATGGGCGCCCGTTTGATGGGAAGGTGGA
AGAGC
GTAAGCGCCGCTCGCATCGCCGAGACGCTAGCTCTAATATCGTCTGAAGGGTGCTCCTGTTGATCTCAGCCCGTTGTTCGACAATGCCACGCTCGGCGCGGATCCGACGCTGAAC
AATAACTTTGACTATACCCACGACAACTCGGACCTCGGCTCTGATCAGACCCATTGCCCATTCAGTGCCCACATCCG
GTATGCATGGATTCGCCCAAATGGGAGCCGGTCAGACCCTGAC
GGAATCTCTCTCTTAGGAAAACGCGTCCCCGCGCGGACTTGAGGTGACAAGCTCCAACTTGCCCGATTCAGCTCTAAACAAACACACCAGTGCGCCCGATAATAGTATAATGAGAGCGGG
CATACCATACGGACCAGAAG
GTGGGGCCGATCTTCGGTCGTGCGACTTAGTGCTGATATCCCCAGTTACGACCGCTGAGCGTACCTCCGCCACGACAGCGTCAGACAGAGGTTTAGCTTT
CGTCTCGTACCAATCGCAAATTGGGAAAGGCTTCAGATTCGTCCAGACTGCGTGGGCCAATACTCAG
GTGCGCGTTCCCTCCCGTCGCGGCAGTGACTTACCACTGAGAGCATTTGTACA
GACTTTTCCGTTCGGGAAGAACGTCACGCCGGGCTTCGACCCGGTGGCGGGCGCGAACAAGGGCCATCTGCGCCTCATGGCGGGATACAATGTCAACAATCAAAGCCTCTCCCTCTCGCT
CCCAACTGATTTTGTCATACCGAAAG
GTGTGTTTGCTCTAAAACCGTAGTTACTGGGTCTTATGGATCTCTTAGGAGGAGAATATTTCTTCGTGCCCTCAATATCAGGCCTTCGGGAGGT
AATTGTCGGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCCGCGCTCCTTCCACTCTTTTCCTCTCTACTTACGGTCAGCCATGCCACGGCTCTCGTCGACCCATCTATCACTGCGCTTCTGAAGATGAAGCGTCGCTTCAACATGCTTCAA
A
ATATCCCCGGTCAGGTGCCACTCCCAGCGGCAGCGGCGGTGGCGCCGTCGCTCAATATCAGCAATATTCAAGGCGACATTTTGGTCGGGATGAAGAAGAAGAACGAGTTATTCTACTTC
TTCCAGATCAACGACGCCCAAGCCTTCAGAACCTGCATGCGCGGCATGGTCTCACAAGTAACGAGCGCGCAGCAACTTCTCTCGACCAGTACACAGCCCGCCGTGGCTCTCAACGTCGCA
TTCTCCCAGACCGGTCTTGCGGCGCTCAGCATCACCGACGACCTCGCTGACAACCCGTTCAAACGCGGCCAGTTTTTGGACGCCACAGCGCTCGGCGACCCTGAGAAAGGCGCCAACTGG
GACCCGGCGTTCAAAGGGACGTCCATTCACGGCGTCTTCCTGATGGCCAGCGACGACCAGGTGCTTCTTGACGCGCAGGTGATTGTGCTGGAAGCGACGTGCGGCGACGGCATGACGAAG
CTGTATTCTCTCGAGGGAGCCATCCGGCCTGGCCTCCAGGCTGGCCACGAAGCATTTGGCTACCTGGATGGCGTTGCGCAGCCACATATTGACGGCTTTGGCCAAGCTTTTCCGGGGCAA
CTGACGGTCGATCCTGGGGTTATTCTCGTTGGCGAGACCGGGGACTCTCAGGCAGCCAGGCGGCCTGCTTGGACGAAGGACGGCTCGTTCATGGCCTTCCGGCAGCT
TAAACAGCTGGTC
CCCGAGTGGAACAAGTTCATCTCGGTCAACGCCCCGAATGTCACCGGCTTGACCAGAGCCCAGAGTGTCTCTCTCATGGGCGCCCGTTTGATGGGAAGGTGGAAGAGC
GGTGCTCCTGTT
GATCTCAGCCCGTTGTTCGACAATGCCACGCTCGGCGCGGATCCGACGCTGAACAATAACTTTGACTATACCCACGACAACTCGGACCTCGGCTCTGATCAGACCCATTGCCCATTCAGT
GCCCACATCCG
GAAAACGCGTCCCCGCGCGGACTTGAGTGCGCCCGATAATAGTATAATGAGAGCGGGCATACCATACGGACCAGAAGTTACGACCGCTGAGCGTACCTCCGCCACGACA
GCGTCAGACAGAGGTTTAGCTTTCGTCTCGTACCAATCGCAAATTGGGAAAGGCTTCAGATTCGTCCAGACTGCGTGGGCCAATACTCAG
ACTTTTCCGTTCGGGAAGAACGTCACGCCG
GGCTTCGACCCGGTGGCGGGCGCGAACAAGGGCCATCTGCGCCTCATGGCGGGATACAATGTCAACAATCAAAGCCTCTCCCTCTCGCTCCCAACTGATTTTGTCATACCGAAAG
GAGGA
GAATATTTCTTCGTGCCCTCAATATCAGGCCTTCGGGAGGTAATTGTCGGATAA

Retrieve as FASTA