Entry information : AdelDyPrx03 (DyP3)
Entry ID 9901
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx03 (DyP3)
Name (synonym) AdelDyPrx03 (DyP3)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx03
start..stop
S start..stop
AdelDyPrx06 693 0 2..454 74..531
AdelDyPrx09 644 0 1..438 88..536
AdelDyPrx05 626 0 1..438 79..511
AdelDyPrx04 603 0 1..438 56..472
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 147335..147776 442 N° 2 147829..147942 114 N° 3 147999..148198 200 N° 4 148251..148310 60
N° 5 148368..148450 83 N° 6 148502..148593 92 N° 7 148645..148917 273 N° 8 148965..149065 101
join(147335..147776,147829..147942,147999..148198,148251..148310,148368..148450, 148502..148593,148645..148917,148965..149065)


exon

Literature and cross-references AdelDyPrx03 (DyP3)
DNA ref. JGI genome:   scaffold_129 (147335..149065)
Protein sequence: AdelDyPrx03 (DyP3)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   454
PWM (Da):   %s   48921.69  
PI (pH):   %s   6.32
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQKHNQLFYFFTIHDAARFKRHLAWDIAPVVASVAQLSQVHRQPLVALNIAFSHAGLLALGVTEDLGDSVFAGGQAADAVQSFNEDTASWVPQFVGDAVHGVILLASDATHLIDRQVFHLEATFGASMSKVYSLPAAIRPGDQAGHEMFGFLDGISQPAIQQLHKTPLPGQNVIDAGVIITGATGDVVDTKDNVPVIRPGWAVGGSFLAFRQLKQLVPEFNQYLLQNAPAGDGSLQARADLMGARMVGRWKGAPVDLAPAADDPELGADPQRNNNFTYEHEGFNLSTDQSHCPFSAHTRKTRPRADLTSLNISDKPNSIMRSGIPYGQVTPEEEASGTTIHERGLAFVAYQSQLAKGFQFLQQSWANNETFPPKKTPAEIGFDPIIGQAADGKARLVAGVDPNNTSATLSMPQFVISRGGEYFFSPPISALRGHLSGVDQVVHEHPGRHRFH

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). The 5'end is short!!= > look EST)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAAACACAACCAGCTTTTCTACTTCTTCACGATCCACGACGCTGCGAGGTTCAAGCGCCATCTCGCATGGGACATCGCGCCGGTCGTCGCGTCCGTCGCGCAGCTCTCGCAGGTT
CACAGGCAGCCGCTCGTCGCCCTCAACATCGCCTTCTCGCACGCCGGGCTACTCGCGCTCGGAGTCACGGAAGACCTCGGCGACAGTGTCTTCGCCGGCGGACAGGCTGCCGATGCCGTT
CAGAGCTTCAACGAGGACACGGCGTCGTGGGTGCCGCAGTTCGTCGGCGACGCGGTCCACGGCGTCATCCTCCTGGCGAGCGACGCCACCCATCTCATCGACAGGCAGGTGTTTCATCTT
GAGGCGACATTCGGCGCGTCTATGTCGAAGGTCTACTCGCTCCCGGCTGCTATCCGCCCGGGTGACCAGGCTGGGCATGAGA
GTACGCACTCGGATTCTCATCATTGCCACCCCGTCCTG
ATTCTCGCTTCCAGTGTTCGGGTTTCTTGACGGCATTTCTCAGCCAGCTATCCAGCAGCTTCACAAGACGCCTCTCCCAGGCCAGAACGTCATCGACGCTGGAGTCATCATCACAGGCGC
CACCGGCG
GTGAGAGGCAACGAGCGAGACAGAGTCCATGCCGTTGACACTTCTTGCATTGGCAGACGTCGTCGACACTAAAGACAACGTGCCCGTCATTCGTCCAGGTTGGGCCGTCGGA
GGGTCCTTCCTCGCGTTCCGCCAACTGAAGCAACTCGTGCCGGAGTTCAACCAGTACCTATTGCAGAATGCTCCGGCCGGCGACGGCAGTCTGCAGGCGCGCGCCGATCTTATGGGGGCG
CGCATGGTCGGACGCTGGAAGTCG
GTGCGTGTGCGGCCAGATTCGGTCGAATGGCGGTCCTAACCAGGATTCGCAGGGAGCGCCCGTCGACCTGGCGCCAGCCGCGGATGATCCAGAGCT
CGGCGCCGACCCTCAG
GTAATGCCTGATCAGCACCATGTGCAGCCTCAGCGCTGAATCGAGATTCGTTCGCAGCGCAACAACAATTTCACGTACGAACACGAAGGCTTTAATCTAAGCAC
GGACCAGAGCCACTGCCCGTTCAGCGCGCATACTAG
GTATGTCGCCAGACATAATTATCACTACCGAACCGGCTAATGTGCGTACAGGAAGACTCGCCCTCGCGCGGACTTGACGTCCCT
CAACATTTCCGATAAGCCTAATTCCATCATGAGAAGCGGCATCCCATATGGACAGGAAG
GTGAGCTGTTTCACTAGAAGTTCACGAGATGTCTCACAAGGATATCAACAGTGACGCCCGA
GGAAGAAGCGTCAGGTACTACAATACACGAACGAGGTCTTGCGTTCGTTGCGTATCAGTCTCAGCTGGCCAAAGGCTTCCAGTTCCTGCAGCAGAGCTGGGCGAACAACGAGACGTTCCC
CCCGAAGAAGACCCCTGCAGAGATTGGATTCGATCCTATCATCGGACAGGCAGCTGATGGTAAGGCTCGCCTTGTCGCCGGGGTGGACCCCAACAACACCAGCGCCACGCTCAGCATGCC
TCAGTTCGTTATCAGCCGTGGCG
GTGAGTACGCTGCCTTCGTACACGACTGATAACTCATGTTGCCGGAGGCGAATACTTCTTCTCTCCCCCCATTTCTGCTCTCAGGGGCCACCTCTCG
GGCGTTGATCAGGTTGTCCACGAGCACCCGGGCCGCCATCGCTTCCACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAAACACAACCAGCTTTTCTACTTCTTCACGATCCACGACGCTGCGAGGTTCAAGCGCCATCTCGCATGGGACATCGCGCCGGTCGTCGCGTCCGTCGCGCAGCTCTCGCAGGTT
CACAGGCAGCCGCTCGTCGCCCTCAACATCGCCTTCTCGCACGCCGGGCTACTCGCGCTCGGAGTCACGGAAGACCTCGGCGACAGTGTCTTCGCCGGCGGACAGGCTGCCGATGCCGTT
CAGAGCTTCAACGAGGACACGGCGTCGTGGGTGCCGCAGTTCGTCGGCGACGCGGTCCACGGCGTCATCCTCCTGGCGAGCGACGCCACCCATCTCATCGACAGGCAGGTGTTTCATCTT
GAGGCGACATTCGGCGCGTCTATGTCGAAGGTCTACTCGCTCCCGGCTGCTATCCGCCCGGGTGACCAGGCTGGGCATGAGA
TGTTCGGGTTTCTTGACGGCATTTCTCAGCCAGCTATC
CAGCAGCTTCACAAGACGCCTCTCCCAGGCCAGAACGTCATCGACGCTGGAGTCATCATCACAGGCGCCACCGGCG
ACGTCGTCGACACTAAAGACAACGTGCCCGTCATTCGTCCAGGT
TGGGCCGTCGGAGGGTCCTTCCTCGCGTTCCGCCAACTGAAGCAACTCGTGCCGGAGTTCAACCAGTACCTATTGCAGAATGCTCCGGCCGGCGACGGCAGTCTGCAGGCGCGCGCCGAT
CTTATGGGGGCGCGCATGGTCGGACGCTGGAAGTCG
GGAGCGCCCGTCGACCTGGCGCCAGCCGCGGATGATCCAGAGCTCGGCGCCGACCCTCAGCGCAACAACAATTTCACGTACGAA
CACGAAGGCTTTAATCTAAGCACGGACCAGAGCCACTGCCCGTTCAGCGCGCATACTAG
GAAGACTCGCCCTCGCGCGGACTTGACGTCCCTCAACATTTCCGATAAGCCTAATTCCATC
ATGAGAAGCGGCATCCCATATGGACAGGAAG
TGACGCCCGAGGAAGAAGCGTCAGGTACTACAATACACGAACGAGGTCTTGCGTTCGTTGCGTATCAGTCTCAGCTGGCCAAAGGCTTC
CAGTTCCTGCAGCAGAGCTGGGCGAACAACGAGACGTTCCCCCCGAAGAAGACCCCTGCAGAGATTGGATTCGATCCTATCATCGGACAGGCAGCTGATGGTAAGGCTCGCCTTGTCGCC
GGGGTGGACCCCAACAACACCAGCGCCACGCTCAGCATGCCTCAGTTCGTTATCAGCCGTGGCG
GCGAATACTTCTTCTCTCCCCCCATTTCTGCTCTCAGGGGCCACCTCTCGGGCGTT
GATCAGGTTGTCCACGAGCACCCGGGCCGCCATCGCTTCCACTGA

Retrieve as FASTA