Entry information : AdelDyPrx07 (DyP7)
Entry ID 9902
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx07 (DyP7)
Name (synonym) AdelDyPrx07 (DyP7)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx07
start..stop
S start..stop
AdelDyPrx09 595 0 3..460 56..537
AdelDyPrx11 576 0 1..460 41..499
AdelDyPrx05 551 0 17..454 61..506
AdelDyPrx02 539 0 35..460 1..431
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 476179..476188 10 N° 2 476044..476128 85 N° 3 475534..475979 446 N° 4 475367..475477 111
N° 5 475076..475314 239 N° 6 474947..475029 83 N° 7 474814..474896 83 N° 8 474431..474756 326
complement(join(474431..474756,474814..474896,474947..475029,475076..475314,4753 67..475477,475534..475979,476044..476128,476179..476188))


exon

Literature and cross-references AdelDyPrx07 (DyP7)
DNA ref. JGI genome:   scaffold_10 (476188..474431)
Protein sequence: AdelDyPrx07 (DyP7)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   461
PWM (Da):   %s   48573.89  
PI (pH):   %s   4.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFKNLAGLPPVPNAQQVSAAALPVDDIQGDILIGMHKLQQLFVFFGINDPATFKTHLANDIAPIVASSAQLANVSTQPLVALNIAFSQSGLTALGVTDNLGDAAFSAGQVNDINNLGETTDTWVPAFVGTSVHGVILLASDDQSLIDQQVGFLDSLFGSSITTLHTLEGSVRPGAEAGHPFGFVDGIAQPALNGFHDPLPGQIVVDPGVIIVGGTNDAIARPSWATGGSFLVFRELQQLVPEFNKFMLDNAPPFEGKTLAQRAALFGARIVGRWKSGAPIDLAPLDDDPALGADPRNNNFDFTHPGSDITSDQSHCPFSAHIRKVRPRADLNGAAPANTILRSGIPFGPVSDDEAASNTTTQLRGLAFVAYQAQIARGFQFLQRAWSNNPNFPPRKSVSPGFDVIIGQNKSAVRTTVGLDVNKPTASISVPQQFVVSRGGEYFFSPPISALTSILVA

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCAAGAGTAAGACGCATACTCTCCATTGATTCTTTCATTTCTGACTATTACCATAGACCTGGCCGGTTTGCCGCCCGTCCCGAACGCTCAGCAGGTTTCAGCAGCTGCCTTGCCCG
TGGACGACATTCAGGGTGACATCCT
GTGAGTCGCATTCTTCGCGGTACCTTACCTTCTATTAAACGCTCTATTAAACGCCGCGTTCCAGGATCGGCATGCACAAGCTTCAGCAGCTGTTC
GTCTTCTTCGGCATCAATGACCCGGCCACGTTCAAGACGCACCTGGCCAATGACATCGCCCCCATTGTCGCTTCGTCGGCTCAGCTGGCCAACGTATCGACCCAGCCCCTCGTCGCCCTC
AACATTGCCTTCTCGCAGTCGGGCCTGACGGCTCTCGGCGTGACGGACAACCTCGGCGACGCGGCGTTCAGCGCTGGGCAGGTCAACGACATCAACAACCTCGGGGAGACGACCGACACC
TGGGTCCCTGCCTTCGTGGGGACGAGCGTGCACGGCGTGATTCTCCTCGCCAGCGACGACCAATCGCTCATCGACCAGCAAGTGGGCTTCCTCGATTCGCTGTTCGGTTCGTCTATTACG
ACGCTCCATACACTCGAAGGCTCGGTTCGCCCAGGTGCTGAGGCTGGCCACGAGC
GTGCGTCGTCTTCATTGCTTCTTTCATTAAGGCCCCGCGTCTAACGCGTGCTGCAGCCTTCGGCT
TCGTGGACGGCATCGCGCAACCTGCTCTCAATGGCTTCCATGACCCCTTGCCCGGTCAAATTGTGGTCGACCCGGGTGTCATCATTGTTGGAGGGACAAATG
GTATGAGAGCCGACACGA
ATGTGGTGATCCACGTACTCATTCAACCTTTCAGACGCCATCGCACGTCCTTCCTGGGCGACTGGAGGCTCCTTCCTTGTGTTCCGCGAGCTGCAGCAACTGGTGCCCGAGTTCAACAAG
TTCATGCTCGATAATGCGCCGCCATTCGAGGGCAAGACGCTCGCTCAACGCGCTGCGCTATTCGGCGCGCGCATTGTTGGCCGCTGGAAGTCCGGTGCTCCGATCGACCTGGCACCTCTC
GATGACGATCCCGCCCTTGGCGCAGACCCCCAG
GTTCGTGGTGGAATATCGTGACTACTGCAGACTGAATGGGCCACAGCGCAACAACAACTTCGACTTCACCCACCCCGGTTCCGATAT
CACCTCGGATCAGAGCCACTGCCCATTCAGCGCACATATTCG
GTACGCCTGAGCTTCCACAGGAACGATTCCATTTCTGAATATATCCCCAGCAAGGTCCGCCCGCGTGCTGACCTGAAT
GGCGCTGCTCCCGCCAACACGATCTTGCGCTCTGGTATTCCTTTCGGCCCCGAAG
GTAAGCACTCAACGGCATCGTCAAAGAAGGCAAGATTCTCATCTCAAATTCTATTAGTGAGCGAT
GATGAGGCGGCATCCAACACCACCACACAACTGCGGGGACTGGCCTTCGTCGCGTACCAAGCGCAAATCGCCCGCGGCTTCCAATTCCTCCAGCGTGCCTGGTCCAACAACCCGAACTTC
CCGCCGCGCAAGAGTGTCAGCCCCGGCTTCGACGTCATCATCGGGCAGAACAAGAGTGCAGTCCGCACTACCGTGGGACTGGATGTCAACAAACCCACGGCCTCTATCAGCGTTCCGCAG
CAGTTCGTTGTCTCGCGGGGAGGCGAATATTTCTTTAGCCCGCCCATCTCTGCGCTCACAAGCATCCTCGTTGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCAAGAACCTGGCCGGTTTGCCGCCCGTCCCGAACGCTCAGCAGGTTTCAGCAGCTGCCTTGCCCGTGGACGACATTCAGGGTGACATCCTGATCGGCATGCACAAGCTTCAGCAG
CTGTTCGTCTTCTTCGGCATCAATGACCCGGCCACGTTCAAGACGCACCTGGCCAATGACATCGCCCCCATTGTCGCTTCGTCGGCTCAGCTGGCCAACGTATCGACCCAGCCCCTCGTC
GCCCTCAACATTGCCTTCTCGCAGTCGGGCCTGACGGCTCTCGGCGTGACGGACAACCTCGGCGACGCGGCGTTCAGCGCTGGGCAGGTCAACGACATCAACAACCTCGGGGAGACGACC
GACACCTGGGTCCCTGCCTTCGTGGGGACGAGCGTGCACGGCGTGATTCTCCTCGCCAGCGACGACCAATCGCTCATCGACCAGCAAGTGGGCTTCCTCGATTCGCTGTTCGGTTCGTCT
ATTACGACGCTCCATACACTCGAAGGCTCGGTTCGCCCAGGTGCTGAGGCTGGCCACGAGC
CCTTCGGCTTCGTGGACGGCATCGCGCAACCTGCTCTCAATGGCTTCCATGACCCCTTG
CCCGGTCAAATTGTGGTCGACCCGGGTGTCATCATTGTTGGAGGGACAAATG
ACGCCATCGCACGTCCTTCCTGGGCGACTGGAGGCTCCTTCCTTGTGTTCCGCGAGCTGCAGCAACTG
GTGCCCGAGTTCAACAAGTTCATGCTCGATAATGCGCCGCCATTCGAGGGCAAGACGCTCGCTCAACGCGCTGCGCTATTCGGCGCGCGCATTGTTGGCCGCTGGAAGTCCGGTGCTCCG
ATCGACCTGGCACCTCTCGATGACGATCCCGCCCTTGGCGCAGACCCCCAG
CGCAACAACAACTTCGACTTCACCCACCCCGGTTCCGATATCACCTCGGATCAGAGCCACTGCCCATTC
AGCGCACATATTCG
CAAGGTCCGCCCGCGTGCTGACCTGAATGGCGCTGCTCCCGCCAACACGATCTTGCGCTCTGGTATTCCTTTCGGCCCCGAAGTGAGCGATGATGAGGCGGCATCC
AACACCACCACACAACTGCGGGGACTGGCCTTCGTCGCGTACCAAGCGCAAATCGCCCGCGGCTTCCAATTCCTCCAGCGTGCCTGGTCCAACAACCCGAACTTCCCGCCGCGCAAGAGT
GTCAGCCCCGGCTTCGACGTCATCATCGGGCAGAACAAGAGTGCAGTCCGCACTACCGTGGGACTGGATGTCAACAAACCCACGGCCTCTATCAGCGTTCCGCAGCAGTTCGTTGTCTCG
CGGGGAGGCGAATATTTCTTTAGCCCGCCCATCTCTGCGCTCACAAGCATCCTCGTTGCGTGA

Retrieve as FASTA