Entry information : AdelDyPrx02 (DyP2)
Entry ID 9903
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx02 (DyP2)
Name (synonym) AdelDyPrx02 (DyP2)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx02
start..stop
S start..stop
AdelDyPrx09 664 0 1..431 88..537
AdelDyPrx05 637 0 1..430 79..511
AdelDyPrx03 600 0 1..430 1..438
AdelDyPrx04 573 0 1..430 56..472
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 229318..229756 439 N° 2 229808..229918 111 N° 3 229967..230148 182 N° 4 230204..230263 60
N° 5 230312..230394 83 N° 6 230442..230524 83 N° 7 230575..230856 282 N° 8 230913..230968 56
join(229318..229756,229808..229918,229967..230148,230204..230263,230312..230394, 230442..230524,230575..230856,230913..230968)


exon

Literature and cross-references AdelDyPrx02 (DyP2)
DNA ref. JGI genome:   scaffold_74 (229318..230968)
Protein sequence: AdelDyPrx02 (DyP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   431
PWM (Da):   %s   45446.87  
PI (pH):   %s   5.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHKQKQVFYFFAINDSATFKSHLASNLAPVVASVTQLSNVASQPLVAVNIAFSNSGLRALNVTEPLGDSVFPAGQAADASSFNEDTNTWKPSFVGTSIHGVLLLASDTDDLVNQQVASIESTFGASISKLYSLSASIRPGAEAGREMFGYLDGIAQPAIIGLNTPLPGQTVVDPGVIITGVGNDPNLSSRPSWAVGGSFLAFRQLEQRVPEFNKYLLDNAPAGSGTVQARADLLGARMVGRWNGAPIDLAPTADDPELGADPHRNNNFTYSHAGFDLASDQSHCPFSAHIRKTRPRDDLAGGAPANSIMRSGIPYGPVTPDESSSNTTALDLERGLAFVAYQSDISKGFRFLQQTWADNAAFPPRKKGPKQVGFDPLIGQAPAGKDRFAAGLDPNNTNATLSVPQFVISHGGEYFFSPPISALSGRLAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACAAGCAGAAGCAAGTCTTCTATTTCTTCGCTATCAACGACTCCGCAACATTCAAGTCGCATCTGGCCTCTAACCTTGCTCCGGTGGTTGCATCGGTCACGCAGCTCTCCAACGTC
GCTTCGCAACCCCTTGTTGCAGTTAATATTGCCTTCTCGAACTCGGGGCTGCGCGCATTGAACGTCACTGAGCCCCTCGGTGACTCAGTCTTTCCAGCCGGTCAGGCTGCCGATGCTAGC
AGCTTCAACGAGGATACCAATACCTGGAAACCATCATTTGTTGGCACCAGCATACACGGCGTCCTCCTCCTGGCCAGCGACACGGATGACCTTGTCAATCAGCAGGTAGCATCTATTGAG
TCGACCTTCGGCGCGTCGATTTCGAAGCTGTACTCGCTGTCAGCGTCGATCCGCCCCGGAGCCGAGGCCGGGCGCGAGA
GTGCGTATACCTCCCGTATCGACGTTTCATCATCCTCAATG
TGTTTCTCAGTGTTCGGCTACCTGGACGGCATCGCCCAACCGGCTATTATTGGTCTCAACACGCCCCTTCCCGGCCAGACTGTCGTCGATCCAGGCGTTATCATTACCGGCGTAGGCAAT
G
GTCTGTGCTCCTTCAAAAATCGTGAGGCATGTCTGACTAGTACGGAAGACCCAAATCTCTCCAGCCGCCCGTCTTGGGCAGTCGGAGGATCTTTCCTGGCATTCCGTCAGCTTGAGCAA
CGCGTCCCTGAGTTCAACAAGTACCTTCTCGACAATGCCCCTGCTGGATCGGGGACCGTCCAGGCGCGTGCGGATCTCCTGGGAGCGCGCATGGTCGGGCGCTGGAACTCG
GTTCGTGGA
TTCACTCGCCAGGAAGACGACGGGAATGACGTTCTTGCGCTCTTAGGGAGCGCCTATCGACCTCGCGCCCACCGCGGACGATCCCGAGCTCGGAGCAGATCCCCATGTACGGCGGAATCG
AGTCACCGCCTCTGCAAATGTTGACTCTTTGCAGCGGAACAACAACTTTACCTATTCCCACGCCGGCTTCGATTTGGCGAGCGACCAGAGCCACTGTCCATTCAGCGCCCACATCAGGTT
CGTTCGCGTCAGGCAAAACCCGCGGTAGACTGACCGCCTCACAGGAAGACACGGCCGCGCGACGACCTCGCCGGAGGCGCGCCCGCAAACTCGATCATGAGGAGCGGAATACCGTATGGA
CCAGAAG
GTATGTTTTCTCCACCTTCCAAGCTGCGAGACGTCTCACAAGTCCACCAGTGACACCTGATGAGTCGTCGTCGAACACCACGGCGCTGGATTTGGAGCGCGGTCTCGCCTTCG
TCGCATACCAGTCCGACATCTCCAAGGGATTCCGCTTCCTGCAGCAGACGTGGGCGGACAACGCGGCGTTCCCTCCCAGGAAGAAGGGCCCGAAGCAGGTCGGCTTCGATCCCCTGATCG
GACAGGCGCCCGCTGGGAAGGATCGTTTCGCTGCTGGACTGGACCCGAACAATACCAATGCGACGCTCAGCGTGCCTCAGTTCGTTATCAGCCACGGCG
GTAAGCACGCGTTCATGTGGT
CCTCAACTCGAAGCTGACATGCGTTATACTCATAGGCGAATATTTCTTCTCTCCTCCGATCTCCGCTCTCAGCGGTCGACTTGCCGCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACAAGCAGAAGCAAGTCTTCTATTTCTTCGCTATCAACGACTCCGCAACATTCAAGTCGCATCTGGCCTCTAACCTTGCTCCGGTGGTTGCATCGGTCACGCAGCTCTCCAACGTC
GCTTCGCAACCCCTTGTTGCAGTTAATATTGCCTTCTCGAACTCGGGGCTGCGCGCATTGAACGTCACTGAGCCCCTCGGTGACTCAGTCTTTCCAGCCGGTCAGGCTGCCGATGCTAGC
AGCTTCAACGAGGATACCAATACCTGGAAACCATCATTTGTTGGCACCAGCATACACGGCGTCCTCCTCCTGGCCAGCGACACGGATGACCTTGTCAATCAGCAGGTAGCATCTATTGAG
TCGACCTTCGGCGCGTCGATTTCGAAGCTGTACTCGCTGTCAGCGTCGATCCGCCCCGGAGCCGAGGCCGGGCGCGAGA
TGTTCGGCTACCTGGACGGCATCGCCCAACCGGCTATTATT
GGTCTCAACACGCCCCTTCCCGGCCAGACTGTCGTCGATCCAGGCGTTATCATTACCGGCGTAGGCAATG
ACCCAAATCTCTCCAGCCGCCCGTCTTGGGCAGTCGGAGGATCTTTCCTG
GCATTCCGTCAGCTTGAGCAACGCGTCCCTGAGTTCAACAAGTACCTTCTCGACAATGCCCCTGCTGGATCGGGGACCGTCCAGGCGCGTGCGGATCTCCTGGGAGCGCGCATGGTCGGG
CGCTGGAACTCG
GGAGCGCCTATCGACCTCGCGCCCACCGCGGACGATCCCGAGCTCGGAGCAGATCCCCATCGGAACAACAACTTTACCTATTCCCACGCCGGCTTCGATTTGGCGAGC
GACCAGAGCCACTGTCCATTCAGCGCCCACATCAG
GAAGACACGGCCGCGCGACGACCTCGCCGGAGGCGCGCCCGCAAACTCGATCATGAGGAGCGGAATACCGTATGGACCAGAAGTG
ACACCTGATGAGTCGTCGTCGAACACCACGGCGCTGGATTTGGAGCGCGGTCTCGCCTTCGTCGCATACCAGTCCGACATCTCCAAGGGATTCCGCTTCCTGCAGCAGACGTGGGCGGAC
AACGCGGCGTTCCCTCCCAGGAAGAAGGGCCCGAAGCAGGTCGGCTTCGATCCCCTGATCGGACAGGCGCCCGCTGGGAAGGATCGTTTCGCTGCTGGACTGGACCCGAACAATACCAAT
GCGACGCTCAGCGTGCCTCAGTTCGTTATCAGCCACGGCG
GCGAATATTTCTTCTCTCCTCCGATCTCCGCTCTCAGCGGTCGACTTGCCGCGTAG

Retrieve as FASTA