Entry information : AdelDyPrx09 (DyP9)
Entry ID 9904
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx09 (DyP9)
Name (synonym) AdelDyPrx09 (DyP9)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx09
start..stop
S start..stop
AdelDyPrx05 734 0 1..536 1..511
AdelDyPrx04 669 0 31..536 10..472
AdelDyPrx02 664 0 88..537 1..431
AdelDyPrx03 644 0 88..536 1..438
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 344210..344378 169 N° 2 344398..344482 85 N° 3 344532..344977 446 N° 4 345031..345141 111
N° 5 345189..345364 176 N° 6 345414..345473 60 N° 7 345529..345611 83 N° 8 345658..346085 428
N° 9 346136..346191 56  
join(344210..344378,344398..344482,344532..344977,345031..345141,345189..345364, 345414..345473,345529..345611,345658..346085,346136..346191)


exon

Literature and cross-references AdelDyPrx09 (DyP9)
DNA ref. JGI genome:   scaffold_17 (344210..346191)
Protein sequence: AdelDyPrx09 (DyP9)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   537 (515)
PWM (Da):   %s   55594.37 (53372.1)  
PI (pH):   %s   5.36 (5.35) Peptide Signal:   %s   cut: 23 range:23-537
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLSPVFVALLTGLLAADLGLARSVARAESNPAAVTGTRKTSLLKSQASPILHTAEDVAGLPPAPSAAQVAATSLNTDDIQGDILVGMHKQKQLFYFFAINDPATFKSHLASDIAPVVASVTQLSNVATQPLVALNIAFSSTGLVALGVGDDLGDAIFAAGQAKDATNFNESTASWVPQFAGTGIHGVILLASDTTDLIDQQVASIESTFGASISKLYSLSSSIRPGAEAGHMFGFLDGIAQPAINGLNPPLPGQNVVDAGVIITGATNDPIQRPSWAVGGSFLAFRQLEQLVPEFNQYLLANAPAGSGSLQSRADLLGARMVGRWKGAPIDLTPTADDPALGADAQRNNNFTYFHDGFNLATDQSHCPFSAHIRKTRPRADLGGSTTPPNLSAPANSIMRSGIPYGPEGAFIRPDGGAICLTRLLVTPGEESSGTTTQERGLAFVAYQAQLARGFHFLQQAWADAVSFPPGKTPSQVGQDPIIGQAPGGAARVVAGLDPNNTNATLSMPQFVISHGEYFFSPPISAISGRLAA

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCTCTCACCCGTCTTCGTCGCTCTCCTTACCGGCCTCCTCGCCGCAGACCTTGGCCTAGCGCGGTCCGTCGCTCGTGCAGAGTCGAACCCGGCCGCCGTTACGGGCACGAGGAAG
ACTAGCCTTCTCAAGAGTCAGGCATCCCCCATACTCCATACTGCCGAGG
GTACTGACCTCTCTTCTAGACGTTGCCGGCCTTCCTCCGGCGCCATCGGCGGCGCAAGTCGCAGCGACATC
GCTGAATACTGATGACATTCAGGGCGATATCCT
GTGCGCTAAATGGCTTCTCTCGCTTCTCTGATTCTAACGTTAGTCTTAGCGTCGGGATGCACAAGCAGAAGCAGCTGTTCTACTTCT
TCGCCATTAACGACCCCGCAACTTTCAAGTCGCACCTCGCCTCCGACATCGCCCCGGTCGTAGCCTCCGTTACTCAGCTCTCTAATGTTGCCACTCAACCACTCGTTGCTCTGAATATCG
CTTTCTCCAGCACGGGTCTCGTCGCATTGGGCGTGGGCGATGACCTCGGTGATGCGATCTTCGCAGCTGGTCAGGCCAAGGATGCGACCAACTTTAACGAGAGCACTGCTTCCTGGGTCC
CCCAGTTTGCGGGAACCGGAATTCATGGCGTCATCCTACTCGCAAGCGACACGACCGACCTCATCGACCAGCAGGTGGCTTCCATCGAGTCGACCTTCGGCGCATCCATCTCCAAGCTCT
ACTCGCTGTCATCCTCAATTCGCCCGGGTGCCGAGGCCGGCCATGAGA
GTATGTCGTTCTTGTATCTCCCACCCGTTCCCCTTGTTCATGAACGTTGGCAGTGTTCGGGTTCCTCGACGG
CATCGCCCAACCAGCCATCAACGGTCTCAACCCTCCGCTCCCAGGGCAAAACGTCGTCGATGCGGGTGTGATCATTACGGGCGCCACCAACG
GTAACCCTTTACCCGCATCACTCCCACA
TAGCTTATCAATATCGTAGACCCCATCCAGCGCCCATCGTGGGCAGTCGGCGGATCGTTCCTCGCCTTCAGGCAGCTCGAGCAGCTCGTGCCTGAGTTCAACCAGTATCTGCTCGCCAAT
GCTCCTGCTGGATCTGGAAGCCTTCAGTCACGCGCCGATCTGCTGGGAGCGCGCATGGTCGGCCGCTGGAAGTCG
GTTAGTGTTTTGCCACATTGGGGACAAGGGTCCTGACTATGATTC
TCAGGGAGCGCCCATCGATCTGACACCAACCGCGGACGACCCCGCGCTCGGTGCCGATGCTCAGGTACGAGTAGTGCAGTCACTGTGCTGTGCAGATGTTTGACGATTCGGATTCGCAGC
GCAACAACAACTTTACATACTTCCACGACGGCTTCAACCTCGCCACTGACCAGAGCCACTGCCCCTTCAGCGCGCACATCAG
GTGAGTAAACAGTGCGACAAAATGCTGTTGGCTAACTC
TTCCTCAGGAAGACTCGCCCTCGCGCCGACCTCGGAGGGAGCACCACCCCGCCTAACCTGTCCGCTCCGGCCAACTCTATCATGAGGAGTGGCATCCCATACGGTCCAGAAGGCGCGTTC
ATCCGACCGGACGGCGGCGCGATATGCCTAACCCGTCTATTAGTGACCCCCGGGGAAGAATCGTCTGGAACCACGACCCAGGAGCGGGGTCTCGCCTTCGTTGCGTATCAGGCCCAACTC
GCGCGCGGTTTCCACTTCCTGCAGCAGGCCTGGGCGGATGCTGTAAGCTTCCCTCCGGGCAAGACACCATCGCAGGTTGGCCAGGACCCCATCATTGGACAGGCGCCCGGTGGTGCAGCT
CGCGTTGTCGCCGGGTTGGACCCCAACAATACCAACGCGACGCTCAGCATGCCCCAGTTCGTTATCAGCCACGGCG
GTGAGCATGCAGCCTTCAGCTTTGAGCCACTTGACTGACGCGGA
TGCCAGGTGAATACTTCTTCTCTCCTCCCATTTCTGCTATCAGTGGGCGTCTTGCCGCGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCTCTCACCCGTCTTCGTCGCTCTCCTTACCGGCCTCCTCGCCGCAGACCTTGGCCTAGCGCGGTCCGTCGCTCGTGCAGAGTCGAACCCGGCCGCCGTTACGGGCACGAGGAAG
ACTAGCCTTCTCAAGAGTCAGGCATCCCCCATACTCCATACTGCCGAGG
ACGTTGCCGGCCTTCCTCCGGCGCCATCGGCGGCGCAAGTCGCAGCGACATCGCTGAATACTGATGACATT
CAGGGCGATATCCT
CGTCGGGATGCACAAGCAGAAGCAGCTGTTCTACTTCTTCGCCATTAACGACCCCGCAACTTTCAAGTCGCACCTCGCCTCCGACATCGCCCCGGTCGTAGCCTCC
GTTACTCAGCTCTCTAATGTTGCCACTCAACCACTCGTTGCTCTGAATATCGCTTTCTCCAGCACGGGTCTCGTCGCATTGGGCGTGGGCGATGACCTCGGTGATGCGATCTTCGCAGCT
GGTCAGGCCAAGGATGCGACCAACTTTAACGAGAGCACTGCTTCCTGGGTCCCCCAGTTTGCGGGAACCGGAATTCATGGCGTCATCCTACTCGCAAGCGACACGACCGACCTCATCGAC
CAGCAGGTGGCTTCCATCGAGTCGACCTTCGGCGCATCCATCTCCAAGCTCTACTCGCTGTCATCCTCAATTCGCCCGGGTGCCGAGGCCGGCCATGAGA
TGTTCGGGTTCCTCGACGGC
ATCGCCCAACCAGCCATCAACGGTCTCAACCCTCCGCTCCCAGGGCAAAACGTCGTCGATGCGGGTGTGATCATTACGGGCGCCACCAACG
ACCCCATCCAGCGCCCATCGTGGGCAGTC
GGCGGATCGTTCCTCGCCTTCAGGCAGCTCGAGCAGCTCGTGCCTGAGTTCAACCAGTATCTGCTCGCCAATGCTCCTGCTGGATCTGGAAGCCTTCAGTCACGCGCCGATCTGCTGGGA
GCGCGCATGGTCGGCCGCTGGAAGTCG
GGAGCGCCCATCGATCTGACACCAACCGCGGACGACCCCGCGCTCGGTGCCGATGCTCAGCGCAACAACAACTTTACATACTTCCACGACGGC
TTCAACCTCGCCACTGACCAGAGCCACTGCCCCTTCAGCGCGCACATCAG
GAAGACTCGCCCTCGCGCCGACCTCGGAGGGAGCACCACCCCGCCTAACCTGTCCGCTCCGGCCAACTCT
ATCATGAGGAGTGGCATCCCATACGGTCCAGAAGGCGCGTTCATCCGACCGGACGGCGGCGCGATATGCCTAACCCGTCTATTAGTGACCCCCGGGGAAGAATCGTCTGGAACCACGACC
CAGGAGCGGGGTCTCGCCTTCGTTGCGTATCAGGCCCAACTCGCGCGCGGTTTCCACTTCCTGCAGCAGGCCTGGGCGGATGCTGTAAGCTTCCCTCCGGGCAAGACACCATCGCAGGTT
GGCCAGGACCCCATCATTGGACAGGCGCCCGGTGGTGCAGCTCGCGTTGTCGCCGGGTTGGACCCCAACAATACCAACGCGACGCTCAGCATGCCCCAGTTCGTTATCAGCCACGGCG
GT
GAATACTTCTTCTCTCCTCCCATTTCTGCTATCAGTGGGCGTCTTGCCGCGTGA

Retrieve as FASTA