Entry information : AdelDyPrx05 (DyP5)
Entry ID 9905
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx05 (DyP5)
Name (synonym) AdelDyPrx05 (DyP5)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx05
start..stop
S start..stop
AdelDyPrx09 740 0 1..511 1..536
AdelDyPrx04 678 0 15..511 1..472
AdelDyPrx02 636 0 79..511 1..430
AdelDyPrx03 627 0 79..511 1..438
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 143007..143133 127 N° 2 143181..143280 100 N° 3 143335..143783 449 N° 4 143832..143969 138
N° 5 144023..144171 149 N° 6 144232..144291 60 N° 7 144342..144424 83 N° 8 144475..144578 104
N° 9 144629..144901 273 N° 10 144950..145005 56  
join(143007..143133,143181..143280,143335..143783,143832..143969,144023..144171, 144232..144291,144342..144424,144475..144578,144629..144901,144950..145005)


exon

Literature and cross-references AdelDyPrx05 (DyP5)
DNA ref. JGI genome:   scaffold_129 (143007..145005)
Protein sequence: AdelDyPrx05 (DyP5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   513
PWM (Da):   %s   53681.14  
PI (pH):   %s   4.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLAPAFESTDPLNVDPGPAVPSALSLSPAAVTGARKKNLLKDIPGLPPPLPVPQAKIASLETASLNTNDIQGDILVGMHKQKQLFYFFAINDVSAFKTHLAADVAPVVASVTQVSNINTQPLVAFNIAFSHSGLVALGVTDDLGDAIFRDGQAADAANSFNESTASWIPQFVGTGIHGVILLASDATGLVDQQVSSIESTFGYSISKVYSVSASIRPGAEAGHTFGFLDGIAQPAIKGLNTPLPGQNIVDAGVIITGAANGESSHDSTFFGGSFLAFRQLEQRVPEFNQYLVDHAPAGAGSLESRAELLGARMVGRWKGAPIDLAPTADDPALGADPQRNNNFTFAHAGSDLSTDQSRCPFSAHIRKTRPRADLGGSLTPPNLSAPTNSIMRSGLPYGPVTREEAESGTTIYERGRAFVAYQAQLANGFHFLQQSWADNETFPPRKTPSQVGFDPIIGQAPGGQDRVVAGLDPNDSTATLSIPQFVISHGGEYFFSPPISALGGRLAE

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTCGCACCCGCCTTCGAGTCTACTGATCCTCTTAACGTGGACCCGGGTCCGGCAGTCCCATCGGCCCTCTCATTGAGCCCAGCTGCCGTGACCGGGGCGAGGAAGAAGAACCTT
CTCAAGG
GTAGGCAACTCTCACACTCTGCGCATATAACTACTGACTCTATTCAGATATTCCTGGTCTTCCCCCGCCGCTCCCCGTGCCACAGGCGAAAATCGCGTCGCTGGAAACCGCAT
CGCTGAATACAAATGATATTCAAGGTGACATTCT
GTGCGTCTTTTTGCTTCTTCCGCTGTGCCATAATCATTCTGACAATGCGTCCAGCGTCGGTATGCATAAGCAGAAGCAGCTGTTCT
ACTTCTTCGCCATCAATGATGTGAGCGCTTTCAAGACTCATCTCGCCGCCGATGTCGCCCCGGTCGTAGCATCCGTTACCCAAGTTTCCAACATCAACACCCAACCTCTCGTCGCATTCA
ACATCGCGTTTTCACACAGTGGACTGGTCGCGCTGGGTGTCACCGATGATCTTGGCGATGCCATCTTCAGGGACGGACAGGCTGCCGACGCCGCCAATAGCTTCAATGAGAGCACTGCGT
CCTGGATTCCGCAGTTTGTTGGGACCGGGATTCACGGAGTTATCCTCCTAGCCAGCGACGCCACCGGTCTCGTCGACCAGCAGGTGTCGAGCATCGAGTCAACCTTCGGCTACTCCATCT
CGAAGGTGTACTCGGTGTCGGCTTCCATCCGCCCCGGGGCAGAGGCTGGCCACGAGA
GTGCGTACACAGACTCGGCCGCTCTTATGCGATCCTGAGCCTGTTCAGCGTTCGGATTCCTCG
ACGGCATCGCTCAGCCGGCGATCAAGGGCCTCAACACACCTCTCCCCGGCCAGAACATCGTCGACGCCGGAGTGATCATCACCGGGGCTGCCAACGGCGAGTCCTCGCACGACTCGACGT
TTT
GTCGCTGACGGAGCGTGCACCGGCAGACCCCATTGAGCGCCCAGCATGGGCAGTCGGCGGGTCGTTCCTCGCTTTCCGTCAGCTCGAGCAACGTGTGCCAGAGTTCAACCAATACCT
AGTCGATCATGCACCTGCCGGGGCCGGAAGCCTCGAGTCTCGCGCCGAGCTTTTGGGTGCGCGCATGGTCGGGCGCTGGAAATCG
GTTCGTGCTGTGGTGTCCGTATTGGGCATGAAGTG
TTTGAGCGCGAGTCTCACCTCACAGGGAGCGCCCATCGACCTTGCGCCGACCGCGGATGACCCGGCGCTCGGCGCTGATCCTCAGGTACGACCTCAAGTCAACCGTTCGGCGTCTATACT
AACAGTTAATGGCAGAGGAACAACAACTTTACATTCGCACACGCCGGCTCTGACCTGAGCACCGACCAGAGCCGCTGCCCCTTCAGCGCGCACATCAGGTCGGTTCCCCTGCGCGACCGC
TGCACAATCTGAGGGCATCCCACTGCAGGAAGACTCGCCCTCGTGCGGACCTGGGCGGAAGTCTCACGCCTCCCAATCTTTCTGCTCCCACAAATTCTATCATGAGGAGTGGTCTCCCCT
ACGGACCAGAGG
GTCTGCCGCCGCCGTATCAATACCGGAAGAACCTCTGACGCAATCCCCAGTGACCCGCGAGGAGGCCGAGTCCGGTACTACGATCTACGAGCGCGGCCGCGCGTTCGT
CGCATACCAGGCTCAGCTCGCCAATGGCTTCCATTTCCTGCAGCAGTCCTGGGCGGACAACGAGACTTTCCCCCCGCGCAAGACTCCCTCGCAGGTTGGGTTCGATCCCATTATCGGGCA
GGCGCCTGGCGGACAGGATCGCGTTGTTGCAGGGTTGGACCCTAACGATTCCACTGCGACGCTCAGCATCCCGCAGTTCGTCATCAGCCATGGCG
GTGAGTACGTTGGCCTCTCCCTCGA
TGTGTGACTTAAGCGCACGATAGGAGAATACTTCTTCTCCCCGCCGATCTCTGCTCTCGGTGGCCGCCTCGCTGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTCGCACCCGCCTTCGAGTCTACTGATCCTCTTAACGTGGACCCGGGTCCGGCAGTCCCATCGGCCCTCTCATTGAGCCCAGCTGCCGTGACCGGGGCGAGGAAGAAGAACCTT
CTCAAGG
ATATTCCTGGTCTTCCCCCGCCGCTCCCCGTGCCACAGGCGAAAATCGCGTCGCTGGAAACCGCATCGCTGAATACAAATGATATTCAAGGTGACATTCTCGTCGGTATGCAT
AAGCAGAAGCAGCTGTTCTACTTCTTCGCCATCAATGATGTGAGCGCTTTCAAGACTCATCTCGCCGCCGATGTCGCCCCGGTCGTAGCATCCGTTACCCAAGTTTCCAACATCAACACC
CAACCTCTCGTCGCATTCAACATCGCGTTTTCACACAGTGGACTGGTCGCGCTGGGTGTCACCGATGATCTTGGCGATGCCATCTTCAGGGACGGACAGGCTGCCGACGCCGCCAATAGC
TTCAATGAGAGCACTGCGTCCTGGATTCCGCAGTTTGTTGGGACCGGGATTCACGGAGTTATCCTCCTAGCCAGCGACGCCACCGGTCTCGTCGACCAGCAGGTGTCGAGCATCGAGTCA
ACCTTCGGCTACTCCATCTCGAAGGTGTACTCGGTGTCGGCTTCCATCCGCCCCGGGGCAGAGGCTGGCCACGAGA
CGTTCGGATTCCTCGACGGCATCGCTCAGCCGGCGATCAAGGGC
CTCAACACACCTCTCCCCGGCCAGAACATCGTCGACGCCGGAGTGATCATCACCGGGGCTGCCAACGGCGAGTCCTCGCACGACTCGACGTTTT
TCGGCGGGTCGTTCCTCGCTTTCCGT
CAGCTCGAGCAACGTGTGCCAGAGTTCAACCAATACCTAGTCGATCATGCACCTGCCGGGGCCGGAAGCCTCGAGTCTCGCGCCGAGCTTTTGGGTGCGCGCATGGTCGGGCGCTGGAAA
TCG
GGAGCGCCCATCGACCTTGCGCCGACCGCGGATGACCCGGCGCTCGGCGCTGATCCTCAGAGGAACAACAACTTTACATTCGCACACGCCGGCTCTGACCTGAGCACCGACCAGAGC
CGCTGCCCCTTCAGCGCGCACATCAG
GAAGACTCGCCCTCGTGCGGACCTGGGCGGAAGTCTCACGCCTCCCAATCTTTCTGCTCCCACAAATTCTATCATGAGGAGTGGTCTCCCCTAC
GGACCAGAGG
TGACCCGCGAGGAGGCCGAGTCCGGTACTACGATCTACGAGCGCGGCCGCGCGTTCGTCGCATACCAGGCTCAGCTCGCCAATGGCTTCCATTTCCTGCAGCAGTCCTGG
GCGGACAACGAGACTTTCCCCCCGCGCAAGACTCCCTCGCAGGTTGGGTTCGATCCCATTATCGGGCAGGCGCCTGGCGGACAGGATCGCGTTGTTGCAGGGTTGGACCCTAACGATTCC
ACTGCGACGCTCAGCATCCCGCAGTTCGTCATCAGCCATGGCG
GAGAATACTTCTTCTCCCCGCCGATCTCTGCTCTCGGTGGCCGCCTCGCTGAGTAA

Retrieve as FASTA