Entry information : AdelDyPrx04 (DyP4)
Entry ID 9910
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: AdelDyPrx04 (DyP4)
Name (synonym) AdelDyPrx04 (DyP4)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelDyPrx04
start..stop
S start..stop
AdelDyPrx09 669 0 10..472 31..536
AdelDyPrx05 668 0 1..472 15..511
AdelDyPrx03 603 0 56..472 1..438
AdelDyPrx06 597 0 5..472 21..515
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 176621..176693 73 N° 2 176479..176563 85 N° 3 175980..176428 449 N° 4 175819..175932 114
N° 5 175579..175727 149 N° 6 175460..175519 60 N° 7 175329..175411 83 N° 8 175196..175275 80
N° 9 174871..175143 273 N° 10 174765..174820 56  
complement(join(174765..174820,174871..175143,175196..175275,175329..175411,1754 60..175519,175579..175727,175819..175932,175980..176428,176479..176563,176621..1 76693))


exon

Literature and cross-references AdelDyPrx04 (DyP4)
DNA ref. JGI genome:   scaffold_25 (176693..174765)
Protein sequence: AdelDyPrx04 (DyP4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   474
PWM (Da):   %s   50266.73  
PI (pH):   %s   7.09
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDPIPAHAVNPAAVRGARKASLLKHVTSLPPPPSAAQVAATSLPTGDIQADILVGMHKNKQLFYFFAIKDVAKFKSHLASDIAPFVTSVKQLADVAAQPLVALNIAFSHTGLLTLGVSDSLGDRLFEGGQEKDAVQSFNESTAKWVSAFVSRSIDGVILLASDSTDLIDQQVSVIESTFGGSISRRHSLRASIRPGGEAGHMFGFLDGISQPAIKGFSMAPLPGQNVVDAGVIIVGATNVGGSFLAFRQLEQMVPEFNKYLLDHAPAGRGSLQERADLLGARMVGRWKGAPLDLAPTADDPALGTDPQRNNNFTFAHHGAQIQTDQSRCPFSAHIRKTRPRADLGDDKPNSIMRSGIPYGPVTPEEIASGTTKHERGLAFVAYQAQLAKGFHFMQRDWANNTSFPPGKIPGEVGFDPIIGQAPGGGDRDVFGLNPHDTTAKLGVPQFVISHGGEYFFSPPISALGGRLSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCTATCCCTGCGCACGCTGTGAACCCAGCCGCGGTGCGCGGCGCGCGGAAGGCGAGTCTACTCAAGCGTGAGTGACTGCGACGTCCCTGGTGGGATGATTTCACCATGTTAACC
GTCTTGCTAGACGTCACGAGCCTCCCTCCGCCGCCTTCCGCTGCTCAGGTTGCCGCCACATCGCTGCCTACCGGTGATATTCAAGCCGATATTCTGTATGGTCGCGCGGGCCTGTCGCTG
TCGAGGATACTAAAGACCCCTCCAGTGTTGGGATGCACAAGAACAAGCAGCTATTCTACTTCTTCGCCATCAAAGACGTCGCGAAATTCAAGTCTCATCTCGCCTCCGACATCGCGCCGT
TCGTAACATCCGTCAAGCAGCTCGCCGATGTCGCCGCTCAGCCGCTCGTTGCTCTCAACATCGCCTTTTCTCACACTGGACTCCTCACGCTGGGCGTATCCGATTCTCTCGGCGATAGGC
TCTTCGAGGGCGGGCAAGAAAAAGACGCCGTCCAGTCCTTCAACGAGAGCACCGCGAAGTGGGTCTCGGCATTTGTCAGCAGGTCCATCGACGGCGTCATCCTTCTGGCCAGCGATTCCA
CCGACCTCATCGACCAGCAGGTATCCGTCATCGAGTCGACGTTCGGTGGATCGATCTCAAGGAGGCACTCTCTGCGGGCCTCCATCCGCCCGGGGGGCGAGGCCGGCCATGAGA
GTACGT
GCATCGACATGAATCTGTCTCGGACGTTGACGATGCCATAGTGTTCGGCTTCCTCGACGGTATCAGCCAGCCCGCCATTAAAGGCTTTTCTATGGCACCTCTCCCTGGCCAGAACGTCGT
TGACGCCGGCGTGATCATCGTCGGCGCCACCAACG
GTTAGTGCATTCCCTTGGAACGAGGCTTGCGACACTGACGGATCGTGCACACACACACTTCTAGACCACGTTCATCGTCCGTCGT
GGGCAGTCGGCGGCTCCTTCCTCGCGTTTCGCCAGCTCGAGCAGATGGTGCCCGAGTTCAACAAGTACCTGCTTGATCATGCCCCCGCCGGGCGCGGCAGCCTTCAAGAACGCGCCGATC
TCCTGGGAGCGCGCATGGTTGGGCGGTGGAAGTCG
GTTCGTGGCGTCTATGATTGCGAAAGTGAATATGGTTTGACCGGGATTTACACTCTCAGGGCGCGCCGCTTGACCTCGCACCGAC
CGCGGACGACCCGGCTCTCGGCACCGACCCTCAG
GTATAACTCTCAGTAGACTTGAGGTCCCAGCGCTGAATGCATTTGAAGCGAAACAACAACTTCACCTTTGCGCACCACGGCGCTCA
AATCCAAACTGATCAGAGCCGCTGCCCCTTCAGTGCGCATATCAG
GTCGGTTCTAGTTGGAACCGGGCGCGGAACTACACCTGTTTACGTGATCACAGGAAGACTCGCCCTCGCGCGGAC
CTCGGGGATGATAAACCCAACTCGATCATGAGGAGCGGCATTCCCTACGGACCAGAAG
GTATGCTACCTCATTAGCCTTGTGCTCGCAAGACTTCTCACCAGAGCACCAGTGACCCCCGA
AGAAATAGCATCCGGAACCACGAAACACGAACGCGGCTTGGCTTTTGTCGCATATCAAGCGCAGCTGGCGAAAGGCTTTCACTTCATGCAGCGGGACTGGGCAAACAACACGTCCTTCCC
CCCTGGGAAAATTCCCGGGGAAGTAGGATTTGACCCCATTATCGGGCAGGCGCCTGGAGGCGGCGACCGCGACGTTTTCGGTTTGAATCCCCACGACACCACCGCGAAGCTCGGCGTCCC
GCAGTTCGTCATCAGCCACGGCG
GTGAGTAGTATGTAAACCTAGCGCTAGATTGCGACTTACACGGGCAACAGGTGAGTATTTCTTCTCTCCTCCTATTTCAGCTCTCGGCGGTCGTCTC
TCCATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCCTATCCCTGCGCACGCTGTGAACCCAGCCGCGGTGCGCGGCGCGCGGAAGGCGAGTCTACTCAAGCACGTCACGAGCCTCCCTCCGCCGCCTTCCGCTGCTCAGGTTGCCGCC
ACATCGCTGCCTACCGGTGATATTCAAGCCGATATTCT
TGTTGGGATGCACAAGAACAAGCAGCTATTCTACTTCTTCGCCATCAAAGACGTCGCGAAATTCAAGTCTCATCTCGCCTCC
GACATCGCGCCGTTCGTAACATCCGTCAAGCAGCTCGCCGATGTCGCCGCTCAGCCGCTCGTTGCTCTCAACATCGCCTTTTCTCACACTGGACTCCTCACGCTGGGCGTATCCGATTCT
CTCGGCGATAGGCTCTTCGAGGGCGGGCAAGAAAAAGACGCCGTCCAGTCCTTCAACGAGAGCACCGCGAAGTGGGTCTCGGCATTTGTCAGCAGGTCCATCGACGGCGTCATCCTTCTG
GCCAGCGATTCCACCGACCTCATCGACCAGCAGGTATCCGTCATCGAGTCGACGTTCGGTGGATCGATCTCAAGGAGGCACTCTCTGCGGGCCTCCATCCGCCCGGGGGGCGAGGCCGGC
CATGAGA
TGTTCGGCTTCCTCGACGGTATCAGCCAGCCCGCCATTAAAGGCTTTTCTATGGCACCTCTCCCTGGCCAGAACGTCGTTGACGCCGGCGTGATCATCGTCGGCGCCACCAAC
G
TCGGCGGCTCCTTCCTCGCGTTTCGCCAGCTCGAGCAGATGGTGCCCGAGTTCAACAAGTACCTGCTTGATCATGCCCCCGCCGGGCGCGGCAGCCTTCAAGAACGCGCCGATCTCCTG
GGAGCGCGCATGGTTGGGCGGTGGAAGTCG
GGCGCGCCGCTTGACCTCGCACCGACCGCGGACGACCCGGCTCTCGGCACCGACCCTCAGCGAAACAACAACTTCACCTTTGCGCACCAC
GGCGCTCAAATCCAAACTGATCAGAGCCGCTGCCCCTTCAGTGCGCATATCAG
GAAGACTCGCCCTCGCGCGGACCTCGGGGATGATAAACCCAACTCGATCATGAGGAGCGGCATTCCC
TACGGACCAGAAG
TGACCCCCGAAGAAATAGCATCCGGAACCACGAAACACGAACGCGGCTTGGCTTTTGTCGCATATCAAGCGCAGCTGGCGAAAGGCTTTCACTTCATGCAGCGGGAC
TGGGCAAACAACACGTCCTTCCCCCCTGGGAAAATTCCCGGGGAAGTAGGATTTGACCCCATTATCGGGCAGGCGCCTGGAGGCGGCGACCGCGACGTTTTCGGTTTGAATCCCCACGAC
ACCACCGCGAAGCTCGGCGTCCCGCAGTTCGTCATCAGCCACGGCG
GTGAGTATTTCTTCTCTCCTCCTATTTCAGCTCTCGGCGGTCGTCTCTCCATGTGA

Retrieve as FASTA