Entry information : HsubDyPrx01
Entry ID 9912
Creation 2011-12-05 (Christophe Dunand)
Last sequence changes 2011-12-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-23 (Catherine Mathe (Scipio))
Peroxidase information: HsubDyPrx01
Name HsubDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Strophariaceae Hypholoma
Organism Hypholoma sublateritium    [TaxId: 71945 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsubDyPrx01
start..stop
S start..stop
HsubDyPrx02 714 0 1..491 1..489
HcyDyPrx02 664 0 1..489 6..484
GmarDyPrx01 643 0 3..489 2..484
LbiDyPrx01 572 0 6..489 24..500
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33298..33356 59 N° 2 33409..33628 220 N° 3 33690..34015 326 N° 4 34071..34381 311
N° 5 34440..34500 61 N° 6 34553..34827 275 N° 7 34883..34940 58 N° 8 34999..35164 166
join(33298..33356,33409..33628,33690..34015,34071..34381,34440..34500,34553..348 27,34883..34940,34999..35164)


exon

Literature and cross-references HsubDyPrx01
DNA ref. JGI genome:   scaffold_101 (33298..35164)
Protein sequence: HsubDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   491
PWM (Da):   %s   53577.79  
PI (pH):   %s   7.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATILPTTTLDFNNIQGDILGGLPKRTETFFLFEIINATKFRKDLNKLIPLVKTVAGVLKDRKDIEDHRKKRLPGLLRLTGVNISFSHLGFILGIDDSSLRPPVDPHAGVLDPFELGQKIDAVINLGDPTKHNGDPDWDESFLRGHIHGVIVITGDSHASVNKKKSEIEVIFGAHTPNASLKEITSIRGDVRPGDQAAHEHFGFLDGISNPAVIGFDTVINPGPRPVNPGVLVTGHPGDPFEIGRADWAKDGSFLAFRYLFQKAPEFNTFLKKHPISEDGNGKVLTPEEGSELLGARMFGRWKGAPIDITPFKDDPILAADSKRNNNFAFEGERSSQFKCPFAAHIRKTNPRDDLEVPPTGTGSVEANRIMRRGIQFGPELTTHEKAMGITEHGRGVLFACYQSSLVNGFQLQQTWSNNPKFPPFTGKPNELPGLDPIIGQGSRSMSGLDPLNPEAQLALPNFVVPRGGEYFFAPSLHGLKGTIAART

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTATTCTTCCTACCACAACGCTGGACTTCAACAACATACAAGGAGACATCTTGTAAGGCAAATTGAATTCACCCCAGAATATTTAAATAACGATGGACTCGTAGAGGTGGTCT
ACCCAAGAGGACTGAGACTTTCTTCTTATTCGAGATTATCAATGCCACGAAATTCAGGAAAGATCTTAACAAGTTAATCCCACTCGTCAAGACCGTGGCTGGCGTTCTCAAGGACAGGAA
GGACATCGAAGACCACAGGAAGAAAAGGCTCCCTGGACTTCTTCGACTGACGGGGGTCAATATTTCTTTCTCTCATCTCGGATTCATCAAG
GTCAAACGGGCATTTATTTTATTTTATTT
CGAGCATATGCTGACGGTCATCGTGATTACAGCTCGGCATTGACGACAGTAGCCTGCGACCGCCTGTAGACCCTCACGCCGGAGTGTTAGATCCTTTCGAGCTTGGTCAGAAGATAGATG
CAGTCATTAACCTCGGAGATCCCACGAAGCACAACGGGGACCCAGACTGGGACGAATCTTTCCTGCGAGGCCACATACACGGAGTCATAGTCATCACCGGCGACAGTCACGCCTCCGTCA
ACAAGAAAAAATCTGAGATCGAGGTCATATTCGGCGCACACACTCCGAATGCATCTCTTAAAGAGATCACCAGCATCCGAGGGGATGTGCGTCCGGGGGACCAGGCTGCACACGAGCA
GT
GAGTGAAATTCTCGCCAGCATATCATTAAGCGCCCGCTGACACAGCCGTCTAGTTTCGGGTTTTTGGATGGAATATCTAACCCAGCGGTTATTGGTTTTGACACGGTCATAAATCCTGGT
CCAAGGCCAGTTAATCCAGGGGTACTTGTGACTGGACACCCAGGGGATCCCTTCGAAATAGGGAGAGCGGACTGGGCTAAGGATGGTAGTTTCCTCGCCTTCCGCTACCTTTTTCAGAAG
GCTCCCGAGTTCAACACATTCTTGAAGAAGCACCCTATTTCAGAAGATGGGAACGGAAAAGTGCTAACGCCAGAGGAAGGGAGCGAGCTTCTTGGCGCGAGGATGTTTGGACGCTGGAAG
AGCG
GTACGCGCTATCTTTTGATCGCGCGTAATTCACCTGAGAAGCCTTGTTTTTATGTTAGGAGCACCGATCGACATAACGCCGTTCAAGGATGACCCTATTCTCGCCGCCGACTCTAA
GAG
GTCAGCATAATAATTCAATCAACGGCACCCATATTGTTGATCGCTTTTACAGAAATAACAATTTTGCATTTGAGGGCGAGCGAAGTTCGCAGTTCAAGTGTCCGTTTGCGGCCCATA
TTCGAAAGACGAACCCACGGGATGATCTCGAGGTACCACCCACTGGCACTGGCTCTGTCGAGGCGAACCGCATCATGCGCCGGGGAATTCAATTTGGACCAGAGTTGACTACACACGAGA
AGGCGATGGGAATAACAGAGCACGGCCGTGGCGTGCTCTTTGCCTGCTACCAGAGCAGCCTCGTCAACGGTTTTCAGTTGCAACAGCAGA
GTGAGTAGGCGCTGAGAGTTTGAAGATTGT
ATATTCTTAAATATGTGCCTTTCAGCTTGGTCAAACAACCCGAAATTCCCGCCTTTCACGGGCAAGCCCAACGAGTTGCCTGGGTGCGTATTTCCGTCGCTGTCAGCTCACCTACCATAT
GTTTATTCGGACTTTAATCAGTTTGGACCCAATCATTGGCCAAGGCTCTCGATCGATGTCTGGACTTGACCCGTTGAACCCGGAAGCGCAATTGGCGTTGCCGAATTTCGTTGTTCCTCG
CGGCGGAGAGTACTTCTTCGCGCCCTCTTTGCACGGGTTGAAGGGGACAATTGCAGCGCGTACTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTATTCTTCCTACCACAACGCTGGACTTCAACAACATACAAGGAGACATCTTAGGTGGTCTACCCAAGAGGACTGAGACTTTCTTCTTATTCGAGATTATCAATGCCACGAAA
TTCAGGAAAGATCTTAACAAGTTAATCCCACTCGTCAAGACCGTGGCTGGCGTTCTCAAGGACAGGAAGGACATCGAAGACCACAGGAAGAAAAGGCTCCCTGGACTTCTTCGACTGACG
GGGGTCAATATTTCTTTCTCTCATCTCGGATTCATCAAG
CTCGGCATTGACGACAGTAGCCTGCGACCGCCTGTAGACCCTCACGCCGGAGTGTTAGATCCTTTCGAGCTTGGTCAGAAG
ATAGATGCAGTCATTAACCTCGGAGATCCCACGAAGCACAACGGGGACCCAGACTGGGACGAATCTTTCCTGCGAGGCCACATACACGGAGTCATAGTCATCACCGGCGACAGTCACGCC
TCCGTCAACAAGAAAAAATCTGAGATCGAGGTCATATTCGGCGCACACACTCCGAATGCATCTCTTAAAGAGATCACCAGCATCCGAGGGGATGTGCGTCCGGGGGACCAGGCTGCACAC
GAGCA
TTTCGGGTTTTTGGATGGAATATCTAACCCAGCGGTTATTGGTTTTGACACGGTCATAAATCCTGGTCCAAGGCCAGTTAATCCAGGGGTACTTGTGACTGGACACCCAGGGGAT
CCCTTCGAAATAGGGAGAGCGGACTGGGCTAAGGATGGTAGTTTCCTCGCCTTCCGCTACCTTTTTCAGAAGGCTCCCGAGTTCAACACATTCTTGAAGAAGCACCCTATTTCAGAAGAT
GGGAACGGAAAAGTGCTAACGCCAGAGGAAGGGAGCGAGCTTCTTGGCGCGAGGATGTTTGGACGCTGGAAGAGCG
GAGCACCGATCGACATAACGCCGTTCAAGGATGACCCTATTCTC
GCCGCCGACTCTAAGAG
AAATAACAATTTTGCATTTGAGGGCGAGCGAAGTTCGCAGTTCAAGTGTCCGTTTGCGGCCCATATTCGAAAGACGAACCCACGGGATGATCTCGAGGTACCA
CCCACTGGCACTGGCTCTGTCGAGGCGAACCGCATCATGCGCCGGGGAATTCAATTTGGACCAGAGTTGACTACACACGAGAAGGCGATGGGAATAACAGAGCACGGCCGTGGCGTGCTC
TTTGCCTGCTACCAGAGCAGCCTCGTCAACGGTTTTCAGTTGCAACAGCAGA
CTTGGTCAAACAACCCGAAATTCCCGCCTTTCACGGGCAAGCCCAACGAGTTGCCTGGTTTGGACCCA
ATCATTGGCCAAGGCTCTCGATCGATGTCTGGACTTGACCCGTTGAACCCGGAAGCGCAATTGGCGTTGCCGAATTTCGTTGTTCCTCGCGGCGGAGAGTACTTCTTCGCGCCCTCTTTG
CACGGGTTGAAGGGGACAATTGCAGCGCGTACTTGA

Retrieve as FASTA