Entry information : MgCP02 (MgKatG2)
Entry ID 9926
Creation 2012-01-02 (Christophe Dunand)
Last sequence changes 2012-06-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-06-06 (Christophe Dunand)
Peroxidase information: MgCP02 (MgKatG2)
Name (synonym) MgCP02 (MgKatG2)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Mycosphaerella graminicola (Septoria tritici)    [TaxId: 54734 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MgCP02
start..stop
S start..stop
TaspCP01 1059 0 11..790 6..791
TatCP02 1059 0 11..790 6..790
TharCP02 1047 0 11..790 6..789
HjCP02 1046 0 5..790 3..788
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5030261..5030585 325 N° 2 5029973..5030200 228 N° 3 5029076..5029906 831 N° 4 5028694..5029016 323
N° 5 5027950..5028633 684  
complement(join(5027950..5028633,5028694..5029016,5029076..5029906,5029973..5030 200,5030261..5030585))


exon

Literature and cross-references MgCP02 (MgKatG2)
Literature Goodwin S.B., Ben M'barek S., Dhillon B., Wittenberg A.H., Crane C.F., Hane J.K., Foster A.J., Van der Lee T.A., Grimwood J., Aerts A., Antoniw J., Bailey A., Bluhm B., Bowler J., Bristow J., van der Burgt A., Canto-Canche B., Churchill A.C., Kema G.H. (2011) Finished genome of the fungal wheat pathogen Mycosphaerella graminicola reveals dispensome structure, chromosome plasticity, and stealth pathogenesis. PLoS Genet. 7:E1002070-E1002070.
Protein ref. GenBank:   EGP91981.1 UniProtKB:   F9X0N6
DNA ref. JGI genome:   chr_1 (5030585..5027950)
Cluster/Prediction ref. JGI gene:   67250
Protein sequence: MgCP02 (MgKatG2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   797 (774)
PWM (Da):   %s   86366.2 (83993.9)  
PI (pH):   %s   4.78 (4.73) Peptide Signal:   %s   cut: 23 range:23-796
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGCLNHLLPVLAITNALGVDALCPALNARGASENILAAPHGNLEARYAAAPPDNGRCSRISKAAGGGTRSHDWWPCELSLNVLRQNAQSTIPLQANFDYATEFAKLDVEELKKDLLKLQTDSQSWWPADFGNYGPFFIRMSWHSAGTYRATDGRGGSGAGQQRFAPLNSWPDNASLDKARRLLWPVKQKYGQKISWADLFVFAGNVAMESMGFPTYGFAFGRVDTWQADESIYWGGEVEIFPSNKSNAVRYDGSDDLADRADKLEDPLAAVDMGLIYVDPRGPNGVPDPLLSAKDIRKTFGRMGMNDTETVALIAGGHAFGKCHGAVKGGSNIGPEPNNAPIEQQGFGWQNSVGTGAGVDAYTSGLEVIWSDKPLEWTNDYLKSLLTNNFTLVQSPDGAPQWEALDGPEIYPDPFVSGKFRRPTMLTSDLALRDDPVYGEISNSFFKDFDLFTEVFSKTWYKLLHRDMGPSFRYLGPYVPKSEPFLWQDPLPAAPSVIIDDADIAQLKSKILGSGLNSSELVTTAWGAASSFRISDKRGGANGGRIALEPQRSWVANNPERLATVLAGLTDVQKQFNSGGKQVSLADLIVLGGAAAIEKAAAEAGVTITVPFTPGRVDATQDQTDVDSFNYLQSKADGFRNYGKGDSRSTTEELLVDKAGQLSLSPPELTVLVGGLRALNANFDGSAVGILTSRPGQLTNDFFANLLDITYTWAPVEGSNNEVFIGTNRNTKEVVYTASRSDLIFGSHPELRAIAEVYASADAQANFVADFVKAWAKVMDLDRYDIKGRPQNDVQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 4 introns) and ESTs. Strain="CBS 115943".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGTTGTCTCAATCATCTGCTGCCCGTGTTGGCCATCACCAACGCCCTCGGTGTCGATGCCCTCTGCCCGGCCTTGAACGCCAGAGGAGCCTCCGAAAACATCCTTGCTGCTCCT
CATGGCAATCTGGAAGCCCGCTACGCCGCTGCTCCACCCGACAATGGCAGATGTTCCCGCATCTCGAAGGCAGCCGGCGGTGGAACTCGTTCCCACGACTGGTGGCCGTGCGAGCTCAGC
CTCAATGTTCTGCGTCAGAACGCGCAGAGCACGATTCCGCTTCAGGCGAATTTCGATTACGCTACGGAGTTCGCCAAGCTTGATG
GTATGTGTTGACGATGCCGAGAACTGACACCAAGG
TGATGCTGACATGGCGGTGATCTAGTCGAGGAACTGAAGAAAGATCTCTTGAAGCTTCAGACCGACTCTCAGTCATGGTGGCCTGCGGACTTCGGCAACTACGGTCCTTTCTTCATCCGG
ATGTCATGGCACAGTGCCGGTACCTACCGAGCGACTGATGGTCGCGGTGGCTCTGGTGCTGGTCAACAGCGTTTCGCTCCTCTGAACAGCTGGCCGGACAATGCCAGCTTGGACAAGGCT
CGACGTTTGTTGT
GTAAGTCTTCTGCATCATGGCTTGCGTGATTTGCCGATGTATGCTGACCTCGCTTGCTCTCTCCAGGGCCGGTCAAGCAGAAGTATGGCCAGAAGATCTCCTGGGCT
GACTTGTTCGTGTTCGCCGGCAACGTCGCCATGGAAAGCATGGGCTTTCCCACGTACGGCTTCGCATTCGGCCGCGTGGATACCTGGCAGGCGGATGAGAGCATCTACTGGGGTGGCGAG
GTCGAGATCTTCCCGAGCAACAAGAGTAACGCGGTCCGTTACGATGGCAGCGATGATCTTGCCGATCGCGCGGACAAACTCGAGGACCCACTTGCAGCCGTGGATATGGGGTTGATCTAC
GTTGATCCTCGTGGACCCAATGGTGTGCCAGACCCGTTGTTGTCTGCCAAGGACATTCGCAAGACCTTTGGCCGTATGGGCATGAACGACACAGAGACCGTGGCCCTGATCGCCGGCGGT
CACGCCTTTGGAAAATGCCATGGTGCCGTCAAAGGCGGCTCGAACATCGGACCCGAACCCAACAATGCACCAATCGAACAGCAAGGATTCGGATGGCAGAACAGCGTCGGCACTGGAGCT
GGTGTAGACGCATACACCAGTGGTCTAGAGGTCATCTGGTCCGACAAGCCGCTCGAATGGACCAACGACTACCTGAAGTCCCTCCTGACGAACAACTTCACTCTCGTCCAGAGCCCAGAT
GGTGCACCTCAGTGGGAGGCACTCGACGGACCAGAGATCTACCCGGATCCATTCGTTTCCGGCAAGTTTCGAAGGCCGACTATGCTGACCAGCGATTTGGCCCTTCGCGACGACCCGGTC
TATGGAGAAATCTCGAACTCCTTCTTCAAGGACTTTGACCTCTTCACAGAAGTGTTCTCCAAGACTTGGT
GTGAGTCCGCCTTCAAGCCATCTGAGCTCGACACACAGATTTGCTGACAC
TTTCCCCAGACAAACTCCTGCACCGCGACATGGGTCCAAGCTTTCGTTATCTGGGACCATATGTTCCTAAATCCGAGCCTTTCCTCTGGCAGGATCCTCTCCCGGCAGCTCCGTCCGTCA
TCATTGACGATGCCGACATCGCCCAACTCAAGAGCAAGATTCTTGGCAGTGGGTTGAACAGCTCAGAGCTTGTCACCACCGCCTGGGGCGCGGCCTCAAGCTTCCGCATCTCTGACAAGC
GCGGCGGAGCCAACGGTGGTCGTATCGCCCTTGAACCTCAGCGCTCTTGGGTGGCCAACAACCCTGAGCGCCTTGCAACAGTTCTAGCAGGC
GTAAGTGAACTATTATCCAGGCTGTCAA
GCTTTGAATGTTGACGCTAACCCGCACCACAGTTGACAGACGTCCAAAAGCAATTCAACTCGGGCGGAAAGCAGGTCTCTCTCGCCGACCTGATCGTTCTCGGTGGTGCCGCAGCCATCG
AAAAAGCCGCCGCAGAAGCCGGAGTCACCATCACCGTGCCCTTCACGCCCGGCCGCGTTGATGCAACCCAGGACCAAACCGATGTCGACTCCTTCAACTACTTACAATCCAAGGCAGACG
GCTTCCGGAACTACGGCAAAGGCGACAGCCGCTCCACAACGGAGGAACTCTTGGTCGACAAGGCCGGCCAGCTATCTCTCAGCCCTCCCGAGCTGACCGTCCTTGTCGGTGGCCTCCGCG
CTTTGAATGCCAACTTCGACGGCTCGGCGGTGGGTATCCTGACTTCCCGCCCGGGTCAGCTTACGAACGACTTTTTCGCCAATCTGTTGGACATCACCTACACGTGGGCGCCGGTTGAAG
GTTCGAACAATGAGGTCTTCATCGGCACGAACAGAAATACCAAGGAGGTGGTGTACACTGCTTCCCGCTCGGACTTGATCTTTGGCTCGCACCCGGAGCTTAGAGCCATTGCGGAGGTGT
ACGCTTCGGCGGACGCGCAGGCTAACTTCGTTGCGGACTTTGTCAAAGCTTGGGCGAAAGTCATGGACTTGGATCGGTATGATATCAAGGGCCGTCCTCAGAACGATGTCCAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGTTGTCTCAATCATCTGCTGCCCGTGTTGGCCATCACCAACGCCCTCGGTGTCGATGCCCTCTGCCCGGCCTTGAACGCCAGAGGAGCCTCCGAAAACATCCTTGCTGCTCCT
CATGGCAATCTGGAAGCCCGCTACGCCGCTGCTCCACCCGACAATGGCAGATGTTCCCGCATCTCGAAGGCAGCCGGCGGTGGAACTCGTTCCCACGACTGGTGGCCGTGCGAGCTCAGC
CTCAATGTTCTGCGTCAGAACGCGCAGAGCACGATTCCGCTTCAGGCGAATTTCGATTACGCTACGGAGTTCGCCAAGCTTGATG
TCGAGGAACTGAAGAAAGATCTCTTGAAGCTTCAG
ACCGACTCTCAGTCATGGTGGCCTGCGGACTTCGGCAACTACGGTCCTTTCTTCATCCGGATGTCATGGCACAGTGCCGGTACCTACCGAGCGACTGATGGTCGCGGTGGCTCTGGTGCT
GGTCAACAGCGTTTCGCTCCTCTGAACAGCTGGCCGGACAATGCCAGCTTGGACAAGGCTCGACGTTTGTTGT
GGCCGGTCAAGCAGAAGTATGGCCAGAAGATCTCCTGGGCTGACTTG
TTCGTGTTCGCCGGCAACGTCGCCATGGAAAGCATGGGCTTTCCCACGTACGGCTTCGCATTCGGCCGCGTGGATACCTGGCAGGCGGATGAGAGCATCTACTGGGGTGGCGAGGTCGAG
ATCTTCCCGAGCAACAAGAGTAACGCGGTCCGTTACGATGGCAGCGATGATCTTGCCGATCGCGCGGACAAACTCGAGGACCCACTTGCAGCCGTGGATATGGGGTTGATCTACGTTGAT
CCTCGTGGACCCAATGGTGTGCCAGACCCGTTGTTGTCTGCCAAGGACATTCGCAAGACCTTTGGCCGTATGGGCATGAACGACACAGAGACCGTGGCCCTGATCGCCGGCGGTCACGCC
TTTGGAAAATGCCATGGTGCCGTCAAAGGCGGCTCGAACATCGGACCCGAACCCAACAATGCACCAATCGAACAGCAAGGATTCGGATGGCAGAACAGCGTCGGCACTGGAGCTGGTGTA
GACGCATACACCAGTGGTCTAGAGGTCATCTGGTCCGACAAGCCGCTCGAATGGACCAACGACTACCTGAAGTCCCTCCTGACGAACAACTTCACTCTCGTCCAGAGCCCAGATGGTGCA
CCTCAGTGGGAGGCACTCGACGGACCAGAGATCTACCCGGATCCATTCGTTTCCGGCAAGTTTCGAAGGCCGACTATGCTGACCAGCGATTTGGCCCTTCGCGACGACCCGGTCTATGGA
GAAATCTCGAACTCCTTCTTCAAGGACTTTGACCTCTTCACAGAAGTGTTCTCCAAGACTTGGT
ACAAACTCCTGCACCGCGACATGGGTCCAAGCTTTCGTTATCTGGGACCATATGTT
CCTAAATCCGAGCCTTTCCTCTGGCAGGATCCTCTCCCGGCAGCTCCGTCCGTCATCATTGACGATGCCGACATCGCCCAACTCAAGAGCAAGATTCTTGGCAGTGGGTTGAACAGCTCA
GAGCTTGTCACCACCGCCTGGGGCGCGGCCTCAAGCTTCCGCATCTCTGACAAGCGCGGCGGAGCCAACGGTGGTCGTATCGCCCTTGAACCTCAGCGCTCTTGGGTGGCCAACAACCCT
GAGCGCCTTGCAACAGTTCTAGCAGGC
TTGACAGACGTCCAAAAGCAATTCAACTCGGGCGGAAAGCAGGTCTCTCTCGCCGACCTGATCGTTCTCGGTGGTGCCGCAGCCATCGAAAAA
GCCGCCGCAGAAGCCGGAGTCACCATCACCGTGCCCTTCACGCCCGGCCGCGTTGATGCAACCCAGGACCAAACCGATGTCGACTCCTTCAACTACTTACAATCCAAGGCAGACGGCTTC
CGGAACTACGGCAAAGGCGACAGCCGCTCCACAACGGAGGAACTCTTGGTCGACAAGGCCGGCCAGCTATCTCTCAGCCCTCCCGAGCTGACCGTCCTTGTCGGTGGCCTCCGCGCTTTG
AATGCCAACTTCGACGGCTCGGCGGTGGGTATCCTGACTTCCCGCCCGGGTCAGCTTACGAACGACTTTTTCGCCAATCTGTTGGACATCACCTACACGTGGGCGCCGGTTGAAGGTTCG
AACAATGAGGTCTTCATCGGCACGAACAGAAATACCAAGGAGGTGGTGTACACTGCTTCCCGCTCGGACTTGATCTTTGGCTCGCACCCGGAGCTTAGAGCCATTGCGGAGGTGTACGCT
TCGGCGGACGCGCAGGCTAACTTCGTTGCGGACTTTGTCAAAGCTTGGGCGAAAGTCATGGACTTGGATCGGTATGATATCAAGGGCCGTCCTCAGAACGATGTCCAGTGA

Retrieve as FASTA