Entry information : PpeAPx03 (ppa010413m)
Entry ID 9948
Creation 2011-12-13 (Qiang Li)
Last sequence changes 2011-12-13 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-31 (Christophe Dunand)
Peroxidase information: PpeAPx03 (ppa010413m)
Name (synonym) PpeAPx03 (ppa010413m)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Rosaceae Prunus
Organism Prunus persica (peach)    [TaxId: 3760 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpeAPx03
start..stop
S start..stop
FaAPx01-1 466 1e-169 1..250 1..250
FaAPx01-2 465 3e-169 1..250 1..250
FaAPx01-3 465 4e-169 1..250 1..250
MdAPx01 455 5e-165 1..250 1..250
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6274736..6274854 119 N° 2 6274946..6275120 175 N° 3 6275248..6275313 66 N° 4 6275921..6275969 49
N° 5 6276068..6276153 86 N° 6 6276283..6276362 80 N° 7 6276453..6276555 103 N° 8 6276645..6276703 59
N° 9 6276818..6276830 13  
join(6274736..6274854,6274946..6275120,6275248..6275313,6275921..6275969,6276068 ..6276153,6276283..6276362,6276453..6276555,6276645..6276703,6276818..6276830)


exon

Literature and cross-references PpeAPx03 (ppa010413m)
DNA ref. Phytozome 12:   scaffold_6 (6274736..6276830)
Protein sequence: PpeAPx03 (ppa010413m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   250
PWM (Da):   %s   27278.77  
PI (pH):   %s   6.31
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSEEYKKAIDKAKRKLRGFIAEKACAPLMLRIAWHSAGTYDSRTKTGGPFGTMKHAAEQSHGANAGLDIAVRLLEPIKQQFPILSYADFYLAGVVAVEITGGPDVPFHPGREDKPEPPPEGRLPDATKGNDHLRDVFGKTMGLSDQDIVALSGGHTGRCHKERSGFEGPWTPNPLIFDNSYFTVLLSEKYDGLLMLPTDTALLSDPVFRPLVEKYADEDAFFADYAAAHQRLSELGFAE

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTACCCTACCGTGAGCGAAGAGTACAAGAAGGCCATCGACAAGGCCAAGAGGAAGCTCAGAGGCTTCATCGCCGAGAAGGCCTGCGCTCCACTCATGCTTCGTATCGCG
TACGTCTCTCTCTCTGTATTTTTCTGTGTGTAAATTGTTCTCTATGTGTTTTTGTGCGAGTGATATTTGATTGCGTGTGGTCGGGTGCAGATGGCATTCTGCTGGTACCTACGATTCGAG
AACAAAAACCGGAGGCCCATTCGGAACTATGAAGCACGCAGCTGAGCAATCGCACGGGGCCAACGCTGGTCTCGATATCGCTGTCAGGCTCTTGGAGCCCATCAAGCAACAGTTCCCAAT
TCTCTCTTACGCTGACTTCTATCAG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTGTTTGTGTTTACAAAAATGAATTAAGGGTTGCTAATTTTTGAATCCGA
TTTGATTTGGTTATTTTAAATTTTGTTTATAGTTGGCTGGTGTTGTTGCTGTTGAGATTACTGGTGGGCCTGATGTCCCCTTCCATCCAGGAAGAGAGGTCAGTAACTTTTGTTTTTCTT
CGTATAATGGATTAGTAAAAGTTGTAATTGTTATTTAATTACTATGAATATATCGAATTTTTCTTTGCCCTTGATCTTGTTTGGGATATTTCGTTTTTTGATGGGATTTTTTGCTTCGTT
TTCAATTGAATGTATGTTATCTGTGTGCTCCTGTTATCTGTGTGCTCCTGGTGCAAGAAACCCAAATACGTCGAGTTAGAAGATTGTATTGCCGTGGATAGTCATCTATTTTGAACGATT
TTATTCCAGAAAGAGCTTAATTTGTTCTGTAAATCAGATTAATAATGTTTGGTTGATCGCCCTCATTTCCTGTAATTGAGTTCGTTATGGTTTCACAACAAATTTTCTTTTGCCTCAGTT
TTTTTTTTTCCTGTGGTTGTTCAGTAGTCTTAGATTTAAACAAATTTGTTTTGACTATTTAGGGAATCTTGATCTTTTTGTGCCTTCTTTTCTTCTTCAAATAAAGGTGTTTGCTTTGCT
ATAATATCAATTGGTTCAGTTTTTGAATTATGCATTGGATATGCTAGTACAATGTTTTGTTTGCTTCATTGTCTTGTTATATTGATATTTCTCTTCTTGTGCCAGGACAAGCCTGAGCCA
CCTCCAGAAGGCCGTCTTCCTGATGCTACCAAGG
GTTGATAATTACATGATCTTATCTCATTGTTTTAGTTTTAGTGTGTTGTTTTGCTGGTTGTGTGTGCGTAATGCTGATATTATGTT
GCAATGCTGCAGGTAATGACCATTTGAGGGATGTCTTTGGCAAAACCATGGGCCTCAGCGACCAGGATATTGTTGCTCTCTCTGGCGGTCACACTCTGGTTTGTTAACTCTTATTGCCCT
TTTTTTTTCTGCTTCGGTGTATATTGTGCTAAGAGATTGCAGTTGGTAATGAAACATTTGTTATTGTGTCAATTTTCTGTATGCTCACTGGTTATGGAACCTTGCAGGGAAGGTGCCACA
AGGAGCGATCTGGATTTGAAGGACCCTGGACTCCCAACCCCCTCATCTTCGACAACTCGTATTTCAC
GTGAGTTTTGTTTCCCTGCTATGCTTTCTTGATACACCTTTTTGCATAGAGCT
ATGCAAGTAATGCATGTAATGTTGTTTGATGTTTTAGGGTGCTCCTGAGTGAAAAGTATGATGGTCTTCTAATGCTTCCAACTGACACTGCCCTTCTGTCTGACCCTGTCTTCCGCCCTC
TTGTTGAAAAATATGCTGCG
GTGCGTGTTTTCTTGAGTTCGAAAAGTTTGCATCTGTGTACTTAAACATTACATTGCTGCATTTCCTGATTGTTAACATTAACTTTCAGGATGAAGATGC
CTTCTTTGCTGATTACGCTGCAGCACACCAGAGGCTTTCTGAGCTTGG
GTAATCTTTATATTCTTATTATGTTGTTTGTGATTAGTTCTAGTTCTACTTCCTCTTGAAGTTTTATTCAAC
ACTGAATTGGCCTTAATTTCGATTACATGCTTTATTTTGTAGGTTTGCTGAGGCC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGAGCTACCCTACCGTGAGCGAAGAGTACAAGAAGGCCATCGACAAGGCCAAGAGGAAGCTCAGAGGCTTCATCGCCGAGAAGGCCTGCGCTCCACTCATGCTTCGTATCGCA
TGGCATTCTGCTGGTACCTACGATTCGAGAACAAAAACCGGAGGCCCATTCGGAACTATGAAGCACGCAGCTGAGCAATCGCACGGGGCCAACGCTGGTCTCGATATCGCTGTCAGGCTC
TTGGAGCCCATCAAGCAACAGTTCCCAATTCTCTCTTACGCTGACTTCTATCAG
TTGGCTGGTGTTGTTGCTGTTGAGATTACTGGTGGGCCTGATGTCCCCTTCCATCCAGGAAGAGAG
GACAAGCCTGAGCCACCTCCAGAAGGCCGTCTTCCTGATGCTACCAAGGGTAATGACCATTTGAGGGATGTCTTTGGCAAAACCATGGGCCTCAGCGACCAGGATATTGTTGCTCTCTCT
GGCGGTCACACTCTG
GGAAGGTGCCACAAGGAGCGATCTGGATTTGAAGGACCCTGGACTCCCAACCCCCTCATCTTCGACAACTCGTATTTCACGGTGCTCCTGAGTGAAAAGTATGAT
GGTCTTCTAATGCTTCCAACTGACACTGCCCTTCTGTCTGACCCTGTCTTCCGCCCTCTTGTTGAAAAATATGCTGCG
GATGAAGATGCCTTCTTTGCTGATTACGCTGCAGCACACCAG
AGGCTTTCTGAGCTTGG
GTTTGCTGAGGCC

Retrieve as FASTA