Entry information : MtPrx110 (Medtr4g074980.1 [4.0]Medtr4g074980.1[3.5] / x)
Entry ID 9957
Creation 2011-11-25 (Qiang LI)
Last sequence changes 2013-12-31 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-04-06 (Catherine Mathe)
Peroxidase information: MtPrx110 (Medtr4g074980.1 [4.0]Medtr4g074980.1[3.5] / x)
Name (synonym) MtPrx110 (Medtr4g074980.1 [4.0]Medtr4g074980.1[3.5] / x)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx110
start..stop
S start..stop
MtPrx76 617 0 1..321 1..320
MtPrx67 577 0 1..321 4..324
GmPrx53 568 0 1..321 1..323
GmPrx197 557 0 1..321 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28587503..28587712 210 N° 2 28587041..28587398 358 N° 3 28586518..28586915 398  
complement(join(28586518..28586915,28587041..28587398,28587503..28587712))


exon

Literature and cross-references MtPrx110 (Medtr4g074980.1 [4.0]Medtr4g074980.1[3.5] / x)
DNA ref. Phytozome 12:   chr4 (28587712..28586516)
Cluster/Prediction ref. Phytozome Gene 12:   31112568 [Incorrect prediction]
Protein sequence: MtPrx110 (Medtr4g074980.1 [4.0]Medtr4g074980.1[3.5] / x)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (298)
PWM (Da):   %s   34524.27 (31925.0)  
PI (pH):   %s   7.93 (7.99) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYRMITSFVVTLVLLGTISCDAQLSSTFYDSTCPNALSTIRTSIRTAISKERRMAASLIRLHFHDCFVQGCDASILLDDSSTIESEKSARPNVNSVRGFEIIDKAKSEVEKVCPGVVSCADILAVAARDASFAVGGPSWTVKLGRRDSTTASKSLANTDLPLFTDDLTTLISHFSKKNLSPKEMVTLSGAHTIGQAQCFTFRGRIYNNASDIDAGFASTRQRGCPSSSTTSNDQKLAALDLVTPNSFDNNYFKNLIQKKGLLQSDQVLFSGGSTNSFVSEYSNNPTTFKSDFATAMIKMGDIEPLTGSAGVIRSICSAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrected prediction from phytozome
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATAGAATGATCACTAGTTTTGTTGTAACATTGGTGCTGCTAGGCACAATATCATGTGATGCCCAATTATCTTCTACATTTTATGACAGTACTTGCCCTAATGCACTAAGCACC
ATCAGAACTTCGATTCGTACTGCAATCTCTAAGGAGCGTCGTATGGCTGCATCTCTCATTCGTCTTCACTTTCATGATTGTTTTGTGCAG
GTAATTACTACACTCATATTTAGGTTTCTA
ATTCAATATGCACACACACTTGCATGCATGCATGCATGTAATATATAATTTGCTAATTCTGAATTAATTTGCAGGGTTGTGATGCATCAATTTTGTTGGATGATAGTTCCACAATCGAGA
GCGAAAAGAGTGCACGTCCAAATGTTAACTCAGTAAGAGGATTTGAAATCATTGATAAAGCAAAATCTGAGGTTGAGAAAGTTTGTCCCGGAGTTGTGTCTTGCGCGGACATACTTGCTG
TGGCAGCACGTGATGCATCATTCGCGGTAGGTGGCCCGTCATGGACAGTAAAACTTGGAAGAAGAGACTCTACAACAGCAAGCAAAAGTTTGGCCAATACCGACCTTCCGTTATTTACAG
ACGATCTTACAACTCTTATATCTCATTTTAGTAAAAAAAATCTCTCCCCCAAAGAGATGGTTACTCTATCCG
GTAAATTTTCATTACTAGTTCATTTGTTTCAAACATGAATATTTTTAT
ATTTGTCTGTATGACTAATTTTTGTGTAACATTTGCCTACATGAAAATTAATATTGGTCAATTTTATTTGAATTTAGGTGCACACACAATCGGACAAGCTCAATGCTTCACATTTCGTGG
CAGAATATACAACAATGCAAGTGACATAGATGCTGGATTTGCTAGCACTCGCCAACGTGGTTGTCCATCTTCCAGTACCACCTCAAACGATCAAAAGTTGGCAGCCCTAGACTTAGTCAC
ACCAAATTCATTTGACAACAATTACTTTAAAAATTTAATTCAAAAGAAGGGTCTTCTTCAATCAGATCAAGTTTTATTCAGTGGAGGGTCTACAAATTCTTTTGTTTCAGAATACAGCAA
CAATCCTACAACTTTCAAATCCGACTTTGCAACTGCTATGATAAAGATGGGAGATATTGAACCCTTAACCGGATCGGCTGGAGTCATAAGAAGCATATGCAGTGCAGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTATAGAATGATCACTAGTTTTGTTGTAACATTGGTGCTGCTAGGCACAATATCATGTGATGCCCAATTATCTTCTACATTTTATGACAGTACTTGCCCTAATGCACTAAGCACC
ATCAGAACTTCGATTCGTACTGCAATCTCTAAGGAGCGTCGTATGGCTGCATCTCTCATTCGTCTTCACTTTCATGATTGTTTTGTGCAG
GGTTGTGATGCATCAATTTTGTTGGATGAT
AGTTCCACAATCGAGAGCGAAAAGAGTGCACGTCCAAATGTTAACTCAGTAAGAGGATTTGAAATCATTGATAAAGCAAAATCTGAGGTTGAGAAAGTTTGTCCCGGAGTTGTGTCTTGC
GCGGACATACTTGCTGTGGCAGCACGTGATGCATCATTCGCGGTAGGTGGCCCGTCATGGACAGTAAAACTTGGAAGAAGAGACTCTACAACAGCAAGCAAAAGTTTGGCCAATACCGAC
CTTCCGTTATTTACAGACGATCTTACAACTCTTATATCTCATTTTAGTAAAAAAAATCTCTCCCCCAAAGAGATGGTTACTCTATCCG
GTGCACACACAATCGGACAAGCTCAATGCTTC
ACATTTCGTGGCAGAATATACAACAATGCAAGTGACATAGATGCTGGATTTGCTAGCACTCGCCAACGTGGTTGTCCATCTTCCAGTACCACCTCAAACGATCAAAAGTTGGCAGCCCTA
GACTTAGTCACACCAAATTCATTTGACAACAATTACTTTAAAAATTTAATTCAAAAGAAGGGTCTTCTTCAATCAGATCAAGTTTTATTCAGTGGAGGGTCTACAAATTCTTTTGTTTCA
GAATACAGCAACAATCCTACAACTTTCAAATCCGACTTTGCAACTGCTATGATAAAGATGGGAGATATTGAACCCTTAACCGGATCGGCTGGAGTCATAAGAAGCATATGCAGTGCAGTC
AACTAA

Retrieve as FASTA