Entry information : AcoPrx101
Entry ID 9968
Creation 2011-11-25 (Qiang LI)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-12 (Christophe Dunand)
Peroxidase information: AcoPrx101
Name AcoPrx101
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx101
start..stop
S start..stop
AcoPrx51 591 0 1..319 1..326
AcoPrx63 517 0 5..319 11..327
AfpPrx23 515 0 5..319 11..328
AcoPrx23 515 0 5..319 11..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1556444..1556653 210 N° 2 1556778..1556972 195 N° 3 1557088..1557642 555  
join(1556444..1556653,1556778..1556972,1557088..1557642)


exon

Literature and cross-references AcoPrx101
DNA ref. Phytozome 12:   scaffold_2 (1556444..1557642)
Protein sequence: AcoPrx101
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (296)
PWM (Da):   %s   34037.94 (31533.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.98 (7.68) Peptide Signal:   %s   cut: 24 range:24-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATPNKIFVLIIFFTTISSPVLAQLSVGFYASTCPSVFDTVRSATRSAINREARMGASLIRLFFHDCFVNGCDGGILLDDTTAVPGEKGTLPNANSARGYEVIDTIKTQVDRACGGSRVSCADILAIAARDSVVELGGPSYSVPVGRRDARAPSRAGTSDLPGFFEDLGPLLSKFSAKGFNAREMVALSGAHTVGQARCAVYRNRIYNDTNIDPAYATSLQANCPRATGTNDGTLAPLDPQSPNRFGNNYFQALINRRTILHSDQELFNGGSTDSIVRDYSDNPSTFSGDFANAMVKMGNLSPLTGTQGEIRTNCRRIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACTCCTAACAAGATTTTTGTCCTCATCATATTCTTCACCACCATCTCATCCCCTGTTTTAGCACAGCTCTCAGTTGGTTTCTATGCTTCTACATGTCCATCAGTATTTGACACT
GTCCGCAGTGCAACACGGTCTGCTATCAATAGAGAAGCTCGTATGGGAGCATCTCTTATTCGTCTCTTCTTCCATGACTGTTTTGTAAAT
GTAAGTTCTGTCTGTACCAACTATATATCA
CTCTACTCAGGGACTCAGGGATTACATATTACTGTTGTCATCTGTTCATTATATTTTAATCACGCATTAATATTTGATTGAATGTTTCATGCAGGGATGTGATGGAGGGATTCTTTTGGA
TGACACAACAGCAGTTCCCGGCGAAAAGGGTACACTGCCTAATGCAAACTCCGCCAGAGGGTATGAGGTGATCGATACTATTAAGACACAAGTTGATAGAGCCTGTGGAGGCTCTAGAGT
GTCCTGTGCTGATATTTTGGCTATTGCAGCGCGTGATTCTGTTGTGGAA
GTGAGTATTTTGTTTTAGACTTTCTATCATCCATGCACATGAAATATTATAAGAAAGAAATTAATAAAAAC
AAAAATTAATGGAAATCTAACTGTGATTTCTTATGATGCAACAGCTTGGAGGACCATCTTATTCAGTCCCAGTAGGAAGAAGAGATGCTAGAGCCCCAAGTAGAGCTGGAACCAGTGATC
TTCCAGGATTTTTCGAGGATCTTGGCCCACTTCTCTCCAAATTCAGTGCTAAGGGATTTAATGCTCGAGAAATGGTTGCATTGTCTGGTGCACACACAGTTGGCCAAGCCCGTTGTGCAG
TATATAGAAACCGAATCTATAACGATACAAATATTGATCCTGCATACGCAACATCACTACAGGCTAATTGCCCACGTGCTACAGGAACTAATGACGGCACCTTGGCTCCTTTAGACCCTC
AAAGTCCAAATCGATTTGGAAATAATTATTTCCAAGCATTGATCAATAGAAGGACAATTCTACATTCTGACCAGGAACTATTTAATGGTGGATCAACAGATTCTATTGTAAGAGATTATA
GTGACAACCCTTCTACTTTCTCAGGCGATTTCGCCAATGCTATGGTGAAGATGGGAAATTTGAGTCCTCTGACTGGTACCCAAGGCGAGATTCGAACAAATTGTAGGAGGATCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACTCCTAACAAGATTTTTGTCCTCATCATATTCTTCACCACCATCTCATCCCCTGTTTTAGCACAGCTCTCAGTTGGTTTCTATGCTTCTACATGTCCATCAGTATTTGACACT
GTCCGCAGTGCAACACGGTCTGCTATCAATAGAGAAGCTCGTATGGGAGCATCTCTTATTCGTCTCTTCTTCCATGACTGTTTTGTAAAT
GGATGTGATGGAGGGATTCTTTTGGATGAC
ACAACAGCAGTTCCCGGCGAAAAGGGTACACTGCCTAATGCAAACTCCGCCAGAGGGTATGAGGTGATCGATACTATTAAGACACAAGTTGATAGAGCCTGTGGAGGCTCTAGAGTGTCC
TGTGCTGATATTTTGGCTATTGCAGCGCGTGATTCTGTTGTGGAA
CTTGGAGGACCATCTTATTCAGTCCCAGTAGGAAGAAGAGATGCTAGAGCCCCAAGTAGAGCTGGAACCAGTGAT
CTTCCAGGATTTTTCGAGGATCTTGGCCCACTTCTCTCCAAATTCAGTGCTAAGGGATTTAATGCTCGAGAAATGGTTGCATTGTCTGGTGCACACACAGTTGGCCAAGCCCGTTGTGCA
GTATATAGAAACCGAATCTATAACGATACAAATATTGATCCTGCATACGCAACATCACTACAGGCTAATTGCCCACGTGCTACAGGAACTAATGACGGCACCTTGGCTCCTTTAGACCCT
CAAAGTCCAAATCGATTTGGAAATAATTATTTCCAAGCATTGATCAATAGAAGGACAATTCTACATTCTGACCAGGAACTATTTAATGGTGGATCAACAGATTCTATTGTAAGAGATTAT
AGTGACAACCCTTCTACTTTCTCAGGCGATTTCGCCAATGCTATGGTGAAGATGGGAAATTTGAGTCCTCTGACTGGTACCCAAGGCGAGATTCGAACAAATTGTAGGAGGATCAATTAA

Retrieve as FASTA