Entry information : PcarPrxQ01
Entry ID 9976
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2012-03-28 (Catherine Mathe (Scipio))
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-23 (Christophe Dunand)
Peroxidase information: PcarPrxQ01
Name PcarPrxQ01
Class Atypical 2-Cysteine peroxiredoxin (type Q)    [Orthogroup: PrxQ001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarPrxQ01
start..stop
S start..stop
PcPrxQ 396 1e-142 1..223 1..231
PplPrxQ01 243 2e-82 5..166 3..164
PinvPrxQ02 211 1e-69 5..158 4..161
SbrePrxQ01 207 2e-68 5..160 4..163
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 103838..103970 133 N° 2 104032..104082 51 N° 3 104136..104233 98 N° 4 104288..104406 119
N° 5 104476..104722 247 N° 6 104746..104772 27  
join(103838..103970,104032..104082,104136..104233,104288..104406,104476..104722, 104746..104772)


exon

Literature and cross-references PcarPrxQ01
DNA ref. JGI genome:   scaffold_9 (103838..104772)
Protein sequence: PcarPrxQ01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   224
PWM (Da):   %s   24326.38  
PI (pH):   %s   5.02
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPRSYPLTDKPAPPLSLPDANGQTYTLNSENVGRPVIIFFYPKSGSYGCTKEACEFRDALIERESFKTTKAQIIGISSDPVEKQKEFVEKHKLYPVLSDSNGEARQTYHIGKGLLGLVDARVTIVIDAKGIVRDSLEATMNYGAHVKFVTKWLEKLEAEEKRASAPPPTEPGLITEPALATEPDPETAPPSTGQAHALIMPTGPENEHESSDVARDELGRAV*

Retrieve as FASTA  
Remarks complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGCTCATACCCCCTCACTGACAAGCCCGCCCCGCCGTTGTCTCTTCCAGATGCCAATGGCCAGACGTACACCCTCAATTCTGAGAACGTCGGACGCCCTGTAATCATCTTCTTC
TACCCAAAATCTG
GTACGTCCCAACCGGGTCTCAGCAGAGATTTGGCCGTTGACGACGTGCTGCATGCGTTCAGGGTCGTATGGGTGCACTAAGGAGGCATGCGAATTTCGCGACGCCTT
GATTG
GTACGTGTCCTTGGAAGTCGAGCGTGAGACGGATTGGGTTCATTGGACTGCAGAAAGGGAGTCTTTCAAGACGACGAAAGCACAAATCATTGGTATCAGCTCAGACCCTGTCGAG
AAGCAGAAGGAATTCGTCGAGAAACACAAGCTAACG
GTACGCAATCAATGACATAGCATGGGAGAAGTCCCACTGACACTCTCATTGCAGTATCCGGTGCTCAGCGACTCGAATGGGGAG
GCAAGACAGACATATCACATAGGCAAAGGCCTGCTTGGCCTTGTCGATGCCCGAGTGACGATCGTGATAGATGCCAAGGGCATCGTACG
GTAAGTGACGCTTCTGGTCTCAACGCCTTCC
CAGACCCGCTCATCCAGAGGACTTTGACCCGATTCCAGGGACTCACTTGAAGCCACGATGAATTACGGTGCACACGTCAAGTTCGTCACTAAATGGCTCGAGAAGCTCGAGGCCGAGGAA
AAGCGGGCTTCTGCACCCCCGCCTACCGAACCTGGTCTTATCACTGAACCAGCCCTCGCAACTGAGCCCGACCCGGAAACGGCACCCCCAAGCACTGGTCAAGCTCACGCGCTGATAATG
CCGACAGGTCCTGAGAATGAGCATGAGAGCTCTGACGTGGCCCCT
GCTGCAACAGGGGTAACGCAAAGCGTGACGAGCTAGGCAGGGCTGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTCGCTCATACCCCCTCACTGACAAGCCCGCCCCGCCGTTGTCTCTTCCAGATGCCAATGGCCAGACGTACACCCTCAATTCTGAGAACGTCGGACGCCCTGTAATCATCTTCTTC
TACCCAAAATCTG
GGTCGTATGGGTGCACTAAGGAGGCATGCGAATTTCGCGACGCCTTGATTGAAAGGGAGTCTTTCAAGACGACGAAAGCACAAATCATTGGTATCAGCTCAGACCCT
GTCGAGAAGCAGAAGGAATTCGTCGAGAAACACAAGCTAACG
TATCCGGTGCTCAGCGACTCGAATGGGGAGGCAAGACAGACATATCACATAGGCAAAGGCCTGCTTGGCCTTGTCGAT
GCCCGAGTGACGATCGTGATAGATGCCAAGGGCATCGTACG
GGACTCACTTGAAGCCACGATGAATTACGGTGCACACGTCAAGTTCGTCACTAAATGGCTCGAGAAGCTCGAGGCCGAG
GAAAAGCGGGCTTCTGCACCCCCGCCTACCGAACCTGGTCTTATCACTGAACCAGCCCTCGCAACTGAGCCCGACCCGGAAACGGCACCCCCAAGCACTGGTCAAGCTCACGCGCTGATA
ATGCCGACAGGTCCTGAGAATGAGCATGAGAGCTCTGACGTGGCCCCT
CGTGACGAGCTAGGCAGGGCTGTCTAA

Retrieve as FASTA