Entry information : PcarNOx01
Entry ID 9980
Creation 2011-12-14 (Christophe Dunand)
Last sequence changes 2011-12-14
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PcarNOx01
Name PcarNOx01
Class Ancestral NADPH oxidase    [Orthogroup: NOx002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarNOx01
start..stop
S start..stop
PcNOx01 1120 0 1..559 1..559
LbiNOx01 977 0 1..559 1..559
PplNOx01-1B 973 0 1..559 1..557
PplNOx01-1A 969 0 1..559 1..557
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3318220..3318330 111 N° 2 3317894..3318164 271 N° 3 3317352..3317842 491 N° 4 3316991..3317297 307
N° 5 3316766..3316930 165 N° 6 3316487..3316716 230 N° 7 3316332..3316424 93 N° 8 3316273..3316284 12
complement(join(3316273..3316284,3316332..3316424,3316487..3316716,3316766..3316 930,3316991..3317297,3317352..3317842,3317894..3318164,3318220..3318330))


exon

Literature and cross-references PcarNOx01
DNA ref. JGI genome:   scaffold_1 (3318330..3316273)
Protein sequence: PcarNOx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   559
PWM (Da):   %s   64070.56 Transmb domain:   %s   i16-38o53-75i137-159o174-196i380-402o
PI (pH):   %s   9.42
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGENWFHREFLNPRRLVFNLFFYGVQLFLFAYGWYSQETNKKLAALNGLKWSVWTSRGAGLVLAFDGGMILVPMLRNIIRVVRPRLAWLFPADENIWFHRQVAYSMAFWAMVHTTAHYVNFFNVERTQVRAERALDIHYTQAGGITGHFMLLIMVLMYTTAHHKVRNQCFEAFWYTHHLAFFFMIGLYTHATGCFVRDSTNPDYIKTFPFYSTEHCLGYESWRFTIWPGIIYFGERIWREIRARRATRLSKVLVHPSGAMELRIVKPTFKYVAGQWLFIQVPDVSGWQWHFTITSAPEDPYVSVHIRQVGDWTQALGERVGASPSVVAAMTQDAMKGKEKDDSLYGTRGNFVELDPARTTRPLPVVRIDGPYGAPAEDVFNVEVAVLVGAGIGVTPFASILKHIWYRQRKGNVGSLRRVEFFWVCRDAPSFGWFQSLLQEVEAAQADPNFLRINIYLTQKINEDMLWNIAVNDAGAEYDPLTLLRSRTMFGRPDWKSIYGRMRDAIETGQYLPGTNAQLKTRVTYFCGPSVLAKAVKEACDATTTSNINFAFAKEHF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGAACTGGTTCCACCGCGAGTTCCTCAACCCCCGACGGCTTGTCTTCAACCTCTTTTTCTATGGCGTTCAGCTCTTCTTGTTCGCATATGGGTGGTACAGCCAGGTGCGTTCA
CCATCCCCATGCGTGGTGACCGCCTGTTTATCTTGATGACTGCCAGGAAACGAACAAGAAGCTAGCTGCTTTGAACGGCCTCAAGTGGTCCGTGTGGACCTCTCGCGGTGCTGGTCTCGT
ACTCGCCTTCGATGGTGGGATGATTCTGGTGCCAATGTTGCGTAACATTATCCGTGTCGTTCGTCCCAGGCTCGCCTGGCTCTTCCCTGCGGACGAGAACATCTGGTTTCACAGACAAGT
CGCGTATTCGATGGCATTCTGGGCTATGGTTCATACCACTGCGCACTACGTGAACTTCTTCAACGTGGAACGCACCC
GTATGTCATGTCCGCTCCTCGCTCGTCTCTGCGTCTGACGCGT
CCCTGCAGAGGTTCGTGCGGAGAGGGCCCTTGATATTCATTACACGCAAGCCGGCGGCATTACTGGCCATTTTATGCTGCTTATAATGGTCCTCATGTACACAACTGCCCACCATAAGGT
CCGCAACCAATGCTTCGAGGCCTTCTGGTACACCCACCACCTCGCATTCTTCTTCATGATTGGCCTCTACACGCACGCCACTGGATGCTTCGTCCGCGACTCCACTAACCCTGACTATAT
CAAGACCTTCCCGTTCTACAGCACGGAACACTGTCTTGGCTATGAAAGCTGGAGATTCACTATCTGGCCTGGCATCATCTATTTCGGCGAGCGTATCTGGCGTGAGATCCGTGCGCGACG
TGCTACTCGCCTGTCGAAGGTTCTGGTCCACCCCAGCGGTGCCATGGAGTTGCGTATCGTCAAGCCTACTTTCAAATACGTTGCCGGTCAATGGCTCTTCATCCAGGTCCCCGATGTCTC
TGGTTGGCAATGGCATCCG
GTAAGTTGCCATGACTCCATCAGTTACCATGCGCTCAGCCCCAAAATACATCAGTTCACCATCACCTCTGCTCCGGAAGATCCGTACGTATCCGTGCATAT
CCGTCAAGTCGGCGATTGGACCCAGGCTCTCGGAGAGCGTGTTGGTGCTAGCCCATCCGTTGTGGCCGCGATGACCCAGGATGCTATGAAGGGTAAAGAGAAGGACGACTCACTGTATGG
CACACGTGGCAACTTCGTCGAGCTTGACCCCGCTCGCACAACCCGTCCTCTGCCTGTTGTTCGCATTGATGGTCCCTACGGTGCCCCAGCTGAGGATGTTTTCAACGTCGAGGTTGCCGT
TCTCGTCGGTGCTGGTATCG
GTATGAATGTTTTACTTGGTAGCTCGCTGACAACCTTCATAACTGATGCCAAACTAACAGGTGTTACTCCATTTGCATCTATCCTGAAGCATATCTGGTA
CCGTCAGCGCAAGGGTAACGTGGGCTCGCTCAGGCGTGTTGAGTTCTTTTGGGTTTGCCGTGATGCTCCGTCCTTTGGTTGGTTCCAGAGCTTGCTTCAGGAAGTTGAGGCTGCTCAAGC
GGATC
GTTAGTTACTTATCTCTCTCACTACTTGTCTAAACTGACTTCATAACAGCCAACTTCCTGCGCATCAACATCTATCTCACCCAGAAGATCAATGAAGACATGCTGTGGAACATTG
CTGTGAACGATGCGGGAGCTGAGTACGATCCACTCACTCTACTTCGGTCGCGTACTATGTTCGGCCGCCCCGACTGGAAGTCTATCTACGGCCGCATGCGTGACGCCATTGAAACCGGCC
AGTACCTGCCAGGTACTAACGCTCAACTCAAGACCAGAGTCGGG
GTGAGATCTTCCTTCAAAAACTCTCTGAATGAATGATGTTGACTCAGGTTTCGTCTCGCAAGACATACTTTTGTGG
CCCAAGCGTCCTCGCCAAGGCTGTTAAGGAAGCTTGTGATGCCACAACCACGTCTAACATCAACTTCGCGTTCGCAAAG
GTGTGTAATCTCTCTTTCTCACGTTTCAGCTATTCATGGTT
TTCCAGGAGCACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGAGAACTGGTTCCACCGCGAGTTCCTCAACCCCCGACGGCTTGTCTTCAACCTCTTTTTCTATGGCGTTCAGCTCTTCTTGTTCGCATATGGGTGGTACAGCCAGGAAACGAAC
AAGAAGCTAGCTGCTTTGAACGGCCTCAAGTGGTCCGTGTGGACCTCTCGCGGTGCTGGTCTCGTACTCGCCTTCGATGGTGGGATGATTCTGGTGCCAATGTTGCGTAACATTATCCGT
GTCGTTCGTCCCAGGCTCGCCTGGCTCTTCCCTGCGGACGAGAACATCTGGTTTCACAGACAAGTCGCGTATTCGATGGCATTCTGGGCTATGGTTCATACCACTGCGCACTACGTGAAC
TTCTTCAACGTGGAACGCACCC
AGGTTCGTGCGGAGAGGGCCCTTGATATTCATTACACGCAAGCCGGCGGCATTACTGGCCATTTTATGCTGCTTATAATGGTCCTCATGTACACAACT
GCCCACCATAAGGTCCGCAACCAATGCTTCGAGGCCTTCTGGTACACCCACCACCTCGCATTCTTCTTCATGATTGGCCTCTACACGCACGCCACTGGATGCTTCGTCCGCGACTCCACT
AACCCTGACTATATCAAGACCTTCCCGTTCTACAGCACGGAACACTGTCTTGGCTATGAAAGCTGGAGATTCACTATCTGGCCTGGCATCATCTATTTCGGCGAGCGTATCTGGCGTGAG
ATCCGTGCGCGACGTGCTACTCGCCTGTCGAAGGTTCTGGTCCACCCCAGCGGTGCCATGGAGTTGCGTATCGTCAAGCCTACTTTCAAATACGTTGCCGGTCAATGGCTCTTCATCCAG
GTCCCCGATGTCTCTGGTTGGCAATGGCATCCG
TTCACCATCACCTCTGCTCCGGAAGATCCGTACGTATCCGTGCATATCCGTCAAGTCGGCGATTGGACCCAGGCTCTCGGAGAGCGT
GTTGGTGCTAGCCCATCCGTTGTGGCCGCGATGACCCAGGATGCTATGAAGGGTAAAGAGAAGGACGACTCACTGTATGGCACACGTGGCAACTTCGTCGAGCTTGACCCCGCTCGCACA
ACCCGTCCTCTGCCTGTTGTTCGCATTGATGGTCCCTACGGTGCCCCAGCTGAGGATGTTTTCAACGTCGAGGTTGCCGTTCTCGTCGGTGCTGGTATCG
GTGTTACTCCATTTGCATCT
ATCCTGAAGCATATCTGGTACCGTCAGCGCAAGGGTAACGTGGGCTCGCTCAGGCGTGTTGAGTTCTTTTGGGTTTGCCGTGATGCTCCGTCCTTTGGTTGGTTCCAGAGCTTGCTTCAG
GAAGTTGAGGCTGCTCAAGCGGATC
CCAACTTCCTGCGCATCAACATCTATCTCACCCAGAAGATCAATGAAGACATGCTGTGGAACATTGCTGTGAACGATGCGGGAGCTGAGTACGAT
CCACTCACTCTACTTCGGTCGCGTACTATGTTCGGCCGCCCCGACTGGAAGTCTATCTACGGCCGCATGCGTGACGCCATTGAAACCGGCCAGTACCTGCCAGGTACTAACGCTCAACTC
AAGACCAGAGTCGGG
ACATACTTTTGTGGCCCAAGCGTCCTCGCCAAGGCTGTTAAGGAAGCTTGTGATGCCACAACCACGTCTAACATCAACTTCGCGTTCGCAAAGGAGCACTTCTGA

Retrieve as FASTA