Entry information : PcarNOx02
Entry ID 9981
Creation 0000-00-00 (Christophe Dunand)
Last sequence changes 2011-12-14 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: PcarNOx02
Name PcarNOx02
Class Ancestral NADPH oxidase    [Orthogroup: NOx001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phanerochaete
Organism Phanerochaete carnosa    [TaxId: 231932 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PcarNOx02
start..stop
S start..stop
PcNOx02 1165 0 1..611 1..609
LbiNOx02 1035 0 8..611 5..604
PplNOx02-1A 1024 0 7..611 7..609
PplNOx02-1B 1021 0 7..611 7..609
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1454875..1455256 382 N° 2 1455313..1455815 503 N° 3 1455877..1456097 221 N° 4 1456148..1456423 276
N° 5 1456478..1456826 349 N° 6 1456878..1456971 94 N° 7 1457031..1457038 8  
join(1454875..1455256,1455313..1455815,1455877..1456097,1456148..1456423,1456478 ..1456826,1456878..1456971,1457031..1457038)


exon

Literature and cross-references PcarNOx02
DNA ref. JGI genome:   scaffold_4 (1454875..1457038)
Protein sequence: PcarNOx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   611
PWM (Da):   %s   70399.27 Transmb domain:   %s   i90-112o127-149i179-201o221-243i256-278o293-311i441-463o
PI (pH):   %s   9.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFYNQKRSSSLDFSDGKVPALEQHPDMNNLALGGNQPSHLQRNKTERRRLQGLQRSNTTTSHTKVEPYKPRSWREKWALWMINEGGRRTFFYVFIFLHVLVLVLGTLHYQLKDNLNTARATFGVTFVIARSAALILHVDVIFILLPVCRNFISLVRRTPLNHYIPFDKNITFHKVTAWSIVWWSFVHIAAHMVNFTKLAFADTDAKTTGQRIVAFLEANFATGPGVTGWIMTAALGIMVWFAIEKRRRAHFEWFWYSHHLFIVFFINWQLHGMFCMIKPDRPPYCSYNTIGVFRYWLVGGVIWIFERILREVRSRHRTYIHKVIQHPSNVMELQIKKEKTTTRAGQYIFLSCPEISYFQWHPFTLTSAPEEDYISVHIRVVGDFTRELAEAVGCDFDKKEKGEKGGDSKVVGTAANPPLNRVLPRVMVDGPFGSASEDFLNYETVLLVGAGIGVTPFASILKSIWYRLNNFNSSKPTRLSKVYFTWVIRDFGSAEWFHSLLHAIEEQDTQNRIEINIYLTAKIKDDDMTNIIVQDVGAEKDAITSLRAPTHFGRPNWDRVFGSIAEKHPETDVGFFCGPAVLSRQLHTMSNKYSHPKGTRFYFGKEN

Retrieve as FASTA  
Remarks complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCTACAACCAGAAGCGTTCCTCCAGCCTCGATTTCTCCGATGGCAAGGTGCCTGCGCTGGAGCAGCACCCGGACATGAACAACCTTGCCTTGGGAGGCAATCAACCGAGCCAC
TTGCAACGCAATAAGACGGAGCGCAGGCGACTCCAGGGACTGCAGAGATCTAATACGACCACTTCGCACACGAAGGTCGAGCCGTATAAGCCTCGCAGCTGGCGCGAGAAATGGGCACTC
TGGATGATCAATGAGGGAGGCAGACGAACGTTCTTCTACGTCTTCATCTTCCTTCATGTGCTCGTCCTCGTCCTCGGGACTTTGCACTACCAGCTCAAGGATAATCTGAACACCGCGCGT
GCTACTTTCGGCGTTACCTTCG
GTGGGTGCTTCATCAAGCCTCTCAACGCCTCACACTCATATCCCCCTGTCTTTCAGTTATCGCTCGTAGCGCTGCTCTTATTCTGCATGTCGATGTCA
TCTTTATCCTCCTGCCCGTCTGCCGTAACTTCATCTCCCTCGTCCGGCGCACCCCTCTGAACCATTACATTCCCTTCGACAAGAATATCACCTTCCATAAGGTGACCGCCTGGTCCATCG
TCTGGTGGAGTTTCGTTCACATTGCCGCACACATGGTCAACTTTACGAAGCTCGCTTTCGCTGACACTGACGCGAAGACCACCGGTCAGCGTATTGTTGCTTTCTTGGAGGCGAACTTCG
CTACCGGTCCTGGTGTGACCGGTTGGATCATGACCGCTGCTTTGGGCATCATGGTGTGGTTTGCGATTGAGAAACGCCGCCGTGCGCACTTCGAGTGGTTCTGGTATTCCCACCACCTCT
TCATCGTCTTCTTCATCAACTGGCAACTCCACGGCATGTTCTGCATGATCAAGCCCGATAGGCCTCCGTATTGCTCGTACAACACTATCGGTGTCTTCTGG
GTACGTACACATTAGCTCC
CCGGCCATACAACGTGCGAACTGAAGAGAACCTCGTATGCAGCGTTACTGGCTCGTCGGTGGTGTTATCTGGATCTTCGAGCGTATCCTTCGCGAAGTTCGTTCCCGTCACAGGACCTAC
ATTCACAAGGTCATCCAACACCCTTCGAACGTGATGGAGCTCCAGATCAAGAAGGAGAAGACCACCACCCGTGCCGGCCAGTACATCTTCCTCTCATGCCCCGAGATCTCCTACTTCCAG
TGGCACCCCTTCACGCTTACCAG
GTATGTGGCGCCGTTATCCCAGGAGTGACACAAGTTGACACGCGTCCCAGTGCTCCGGAGGAGGATTACATTTCCGTCCACATCCGTGTTGTCGGCG
ACTTCACCAGGGAGCTGGCCGAGGCTGTTGGGTGCGACTTCGACAAGAAGGAGAAGGGCGAGAAAGGTGGTGACAGCAAAGTTGTCGGCACTGCGGCCAACCCTCCACTCAACCGTGTCC
TTCCCCGAGTCATGGTCGATGGTCCGTTTGGCAGCGCAAGTGAGGATTTCCTAAACTATGAGACCGTGCTGCTTGTCGGTGCTGGTATCGGTGTGACACCGTTTGCCTC
GTGAGTATCAG
CCTCCCAGTGTGACTTGAGACGGTACTTATAATGTTGCCGCAGGATCTTGAAATCGATTTGGTATCGCCTGAACAACTTCAACAGCTCGAAGCCCACTCGCCTGTCCAAGGTGTACTTCA
CTTGGGTCATCCGTGACTTCGGCAGCGCTGAGTGGTTCCACTCCCTGCTGCACGCCATCGAGGAACAGGACACCCAGAACCGCATCGAGATCAACATCTACCTGACCGCCAAGATTAAGG
ACGACGACATGACCAACATTATTGTCCAAGACGTCGGCGCAGAGAAGGATGCAATCACGTCGCTTCGGGCTCCAACTCACTTTGGTCGGCCCAACTGGGATCGTGTGTTCGGTTCTATCG
CTGAGAAGCATCCTGAAACCGACGTTGGTGTG
GTATGTGGGATCATCTTGCAGTCTTGACCTCATCTCACTGTCGTTGGCCAGTTCTTTTGCGGTCCAGCTGTGCTCTCTCGTCAGCTGC
ACACAATGAGCAACAAGTACTCACACCCTAAGGGCACGAGGTTTTACTTCGGGAAGG
GTACGCCTACATCGTTTCTTCCACGCGAGTCGACTCACTAATATATACCCCTCCGACAGAGAA
CTTC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTTCTACAACCAGAAGCGTTCCTCCAGCCTCGATTTCTCCGATGGCAAGGTGCCTGCGCTGGAGCAGCACCCGGACATGAACAACCTTGCCTTGGGAGGCAATCAACCGAGCCAC
TTGCAACGCAATAAGACGGAGCGCAGGCGACTCCAGGGACTGCAGAGATCTAATACGACCACTTCGCACACGAAGGTCGAGCCGTATAAGCCTCGCAGCTGGCGCGAGAAATGGGCACTC
TGGATGATCAATGAGGGAGGCAGACGAACGTTCTTCTACGTCTTCATCTTCCTTCATGTGCTCGTCCTCGTCCTCGGGACTTTGCACTACCAGCTCAAGGATAATCTGAACACCGCGCGT
GCTACTTTCGGCGTTACCTTCG
TTATCGCTCGTAGCGCTGCTCTTATTCTGCATGTCGATGTCATCTTTATCCTCCTGCCCGTCTGCCGTAACTTCATCTCCCTCGTCCGGCGCACCCCT
CTGAACCATTACATTCCCTTCGACAAGAATATCACCTTCCATAAGGTGACCGCCTGGTCCATCGTCTGGTGGAGTTTCGTTCACATTGCCGCACACATGGTCAACTTTACGAAGCTCGCT
TTCGCTGACACTGACGCGAAGACCACCGGTCAGCGTATTGTTGCTTTCTTGGAGGCGAACTTCGCTACCGGTCCTGGTGTGACCGGTTGGATCATGACCGCTGCTTTGGGCATCATGGTG
TGGTTTGCGATTGAGAAACGCCGCCGTGCGCACTTCGAGTGGTTCTGGTATTCCCACCACCTCTTCATCGTCTTCTTCATCAACTGGCAACTCCACGGCATGTTCTGCATGATCAAGCCC
GATAGGCCTCCGTATTGCTCGTACAACACTATCGGTGTCTTCTGG
CGTTACTGGCTCGTCGGTGGTGTTATCTGGATCTTCGAGCGTATCCTTCGCGAAGTTCGTTCCCGTCACAGGACC
TACATTCACAAGGTCATCCAACACCCTTCGAACGTGATGGAGCTCCAGATCAAGAAGGAGAAGACCACCACCCGTGCCGGCCAGTACATCTTCCTCTCATGCCCCGAGATCTCCTACTTC
CAGTGGCACCCCTTCACGCTTACCAG
TGCTCCGGAGGAGGATTACATTTCCGTCCACATCCGTGTTGTCGGCGACTTCACCAGGGAGCTGGCCGAGGCTGTTGGGTGCGACTTCGACAAG
AAGGAGAAGGGCGAGAAAGGTGGTGACAGCAAAGTTGTCGGCACTGCGGCCAACCCTCCACTCAACCGTGTCCTTCCCCGAGTCATGGTCGATGGTCCGTTTGGCAGCGCAAGTGAGGAT
TTCCTAAACTATGAGACCGTGCTGCTTGTCGGTGCTGGTATCGGTGTGACACCGTTTGCCTC
GATCTTGAAATCGATTTGGTATCGCCTGAACAACTTCAACAGCTCGAAGCCCACTCGC
CTGTCCAAGGTGTACTTCACTTGGGTCATCCGTGACTTCGGCAGCGCTGAGTGGTTCCACTCCCTGCTGCACGCCATCGAGGAACAGGACACCCAGAACCGCATCGAGATCAACATCTAC
CTGACCGCCAAGATTAAGGACGACGACATGACCAACATTATTGTCCAAGACGTCGGCGCAGAGAAGGATGCAATCACGTCGCTTCGGGCTCCAACTCACTTTGGTCGGCCCAACTGGGAT
CGTGTGTTCGGTTCTATCGCTGAGAAGCATCCTGAAACCGACGTTGGTGTG
TTCTTTTGCGGTCCAGCTGTGCTCTCTCGTCAGCTGCACACAATGAGCAACAAGTACTCACACCCTAAG
GGCACGAGGTTTTACTTCGGGAAGG
AGAACTTC

Retrieve as FASTA