Entry information : AcoPrx[P]114
Entry ID 9991
Creation 2011-12-14 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Not yet reviewed
Last annotation changes 2011-12-14 (Qiang Li)
Peroxidase information: AcoPrx[P]114
Name AcoPrx[P]114
Class Class III peroxidase    [Orthogroup: N/D] N/D
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx[P]114
start..stop
S start..stop
AcoPrx[P]111 101 1e-30 1..64 1..90
AcoPrx[P]113 97 8e-29 1..64 1..79
AcoPrx102 100 9e-29 1..64 1..86
AcoPrx54 84 2e-21 1..59 224..300
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 248375..248446 72 N° 2 248527..248646 120  
join(248375..248446,248527..248646)


exon

Literature and cross-references AcoPrx[P]114
DNA ref. Phytozome 12:   scaffold_118 (248375..248646)
Protein sequence: AcoPrx[P]114
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   64
PWM (Da):   %s   6860.2  
PI (pH):   %s   3.79
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
DGNDTIVYIGGVEITQPDFFYNGLMTPLSFSSSQSENRTNAQSINTTPSPAIMCIMLKDATMEF

Retrieve as FASTA  
Remarks Pseudogene from genomic (Very short PS). No prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATGGAAATGATACGATCGTGTACATTGGTGGAGTAGAGATTACTCAACCTGATTTCTTCTACAATGGTCTCCTAGACTCCTAGTTGTTCATCGTTTTGAAGGTTTTATCAATACTTTTT
CTCTGTCGTTCTCATCATTTAACATGGAAAGGATGACTCCTCTATCTTTTTCTTCATCACAATCTGAGAATCGAACCAATGCACAATCAATCAATACTACTCCTTCCCCTGCTATTATGT
GTATAATGCTTAAAGATGCTACTATGGAGTTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GATGGAAATGATACGATCGTGTACATTGGTGGAGTAGAGATTACTCAACCTGATTTCTTCTACAATGGTCTCATGACTCCTCTATCTTTTTCTTCATCACAATCTGAGAATCGAACCAAT
GCACAATCAATCAATACTACTCCTTCCCCTGCTATTATGTGTATAATGCTTAAAGATGCTACTATGGAGTTT

Retrieve as FASTA