Entry information : AcoPrx115 (Aqcoe5G071400 [3.1])
Entry ID 9998
Creation 2011-12-14 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-19 (Christophe Dunand)
Peroxidase information: AcoPrx115 (Aqcoe5G071400 [3.1])
Name (synonym) AcoPrx115 (Aqcoe5G071400 [3.1])
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Ranunculaceae Aquilegia
Organism Aquilegia coerulea     [TaxId: 218851 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AcoPrx115
start..stop
S start..stop
AcoPrx32 667 0 1..326 1..326
AcoPrx116 667 0 1..326 1..326
MePrx88 515 0 8..326 2..320
CmicPrx01 513 0 1..326 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1991705..1991920 216 N° 2 1992099..1992290 192 N° 3 1992388..1992553 166 N° 4 1992675..1993081 407
join(1991705..1991920,1992099..1992290,1992388..1992553,1992675..1993081)


exon

Literature and cross-references AcoPrx115 (Aqcoe5G071400 [3.1])
DNA ref. Phytozome 12:   scaffold_17 (1991705..1993081)
Protein sequence: AcoPrx115 (Aqcoe5G071400 [3.1])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   35502.77 (32862.4) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.92 (8.01) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTSFFDFLLVCLVLFGVAGICHAGELRKNFYEDSCPQAEEVIKNIIWKHVASNSALPAKFLRMHFHDCFVRGCDASLLLNSTANNKAEKEAVPNLSVSGFDVIDEVKAHLEKTCPGTVSCADIVALAARDSVSFQFQKSIWEVLTGRRDGSISRQSEALANIPSPFSSFTTLKSNFSSKGLTVHDLVVLSGAHTIGVGHCNFFSNRLYNFTGKGDSDPSLNSKYATFLKTKCRSLLDNTTTVAMDPESSLSFDTSYFVNLKEQKGMFQSDAALLTNKGASNIVDEMLISGKFFTEFAQSMKRMGAIGVLTGNSGEIRRKCGVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 5, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTAGCTTCTTTGATTTTCTGTTGGTGTGCTTAGTACTTTTTGGGGTTGCAGGTATTTGCCATGCAGGCGAATTAAGGAAGAATTTCTACGAGGACAGTTGCCCTCAAGCTGAG
GAGGTTATCAAGAACATCATCTGGAAACATGTAGCTAGCAATTCAGCATTGCCTGCAAAGTTTCTAAGGATGCATTTTCATGACTGCTTTGTTAGG
GTAACAAATCTCAATTTAATGCAT
ATCGTTACAGTAGCTTGCTTCTGTGCATCTTTTAATATTTTGACAACGTGTTCATTATTACGCAAGTGGTTTTATATTTATCCGCATGGACAGACGCCAGACTCTTCTTCTGTAAAGTAC
CAATTCAGTTCATAACAAGCCAATATTCTTTCAGGGTTGTGATGCTTCATTGTTACTAAACTCTACTGCAAATAATAAAGCTGAAAAGGAAGCAGTACCAAACCTATCGGTTTCAGGTTT
TGATGTTATTGACGAGGTGAAGGCTCACCTAGAGAAGACTTGCCCTGGAACTGTTTCCTGTGCAGATATTGTTGCTTTGGCTGCTAGGGATTCTGTTTCCTTCCAA
GTAAGTTTTAGTTA
CTAGTGATAAACAGAGACATGTCATAAGTCATAACTCATATGGTTCAACTTGGTTAGCTTGACTTTGCTCATCGTGGTTGCAGTTCCAAAAATCAATCTGGGAAGTATTAACAGGCAGAA
GAGATGGTAGCATCTCACGCCAATCGGAAGCTCTTGCTAACATACCTTCGCCTTTCTCCAGCTTCACCACTCTTAAGTCAAACTTTAGTAGCAAAGGCCTTACTGTTCACGACCTTGTGG
TTTTGTCAG
GTATGCATTGTGAACTAAGTTGATCTAATGCCATAGTTTTCTGTTTGTCATAATCCTTTTTCATTTTATGTTTTGTTCGTGATGTATATGTACTAAATTCGCACTGGCTTG
TTATATGCAGGCGCACATACCATAGGTGTGGGACATTGTAATTTTTTTAGCAACAGACTCTACAATTTTACTGGAAAAGGAGACTCGGATCCTTCCTTAAACTCAAAATATGCAACTTTC
TTAAAAACAAAATGCCGAAGTCTTTTAGACAACACCACCACAGTAGCAATGGACCCTGAAAGTTCATTATCATTTGATACTAGTTATTTTGTCAACTTGAAAGAACAAAAGGGTATGTTT
CAATCCGATGCTGCCCTTTTAACAAACAAGGGAGCATCCAACATTGTTGATGAAATGCTCATCTCTGGAAAGTTCTTTACTGAATTTGCACAATCCATGAAGAGGATGGGTGCCATTGGA
GTCCTTACTGGAAATTCTGGAGAGATTAGGAGAAAATGTGGTGTTGTTAACTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTAGCTTCTTTGATTTTCTGTTGGTGTGCTTAGTACTTTTTGGGGTTGCAGGTATTTGCCATGCAGGCGAATTAAGGAAGAATTTCTACGAGGACAGTTGCCCTCAAGCTGAG
GAGGTTATCAAGAACATCATCTGGAAACATGTAGCTAGCAATTCAGCATTGCCTGCAAAGTTTCTAAGGATGCATTTTCATGACTGCTTTGTTAGG
GGTTGTGATGCTTCATTGTTACTA
AACTCTACTGCAAATAATAAAGCTGAAAAGGAAGCAGTACCAAACCTATCGGTTTCAGGTTTTGATGTTATTGACGAGGTGAAGGCTCACCTAGAGAAGACTTGCCCTGGAACTGTTTCC
TGTGCAGATATTGTTGCTTTGGCTGCTAGGGATTCTGTTTCCTTCCAA
TTCCAAAAATCAATCTGGGAAGTATTAACAGGCAGAAGAGATGGTAGCATCTCACGCCAATCGGAAGCTCTT
GCTAACATACCTTCGCCTTTCTCCAGCTTCACCACTCTTAAGTCAAACTTTAGTAGCAAAGGCCTTACTGTTCACGACCTTGTGGTTTTGTCAG
GCGCACATACCATAGGTGTGGGACAT
TGTAATTTTTTTAGCAACAGACTCTACAATTTTACTGGAAAAGGAGACTCGGATCCTTCCTTAAACTCAAAATATGCAACTTTCTTAAAAACAAAATGCCGAAGTCTTTTAGACAACACC
ACCACAGTAGCAATGGACCCTGAAAGTTCATTATCATTTGATACTAGTTATTTTGTCAACTTGAAAGAACAAAAGGGTATGTTTCAATCCGATGCTGCCCTTTTAACAAACAAGGGAGCA
TCCAACATTGTTGATGAAATGCTCATCTCTGGAAAGTTCTTTACTGAATTTGCACAATCCATGAAGAGGATGGGTGCCATTGGAGTCCTTACTGGAAATTCTGGAGAGATTAGGAGAAAA
TGTGGTGTTGTTAACTCTTAA

Retrieve as FASTA